Description :
From Genome Similarity Track
Location :
Scaffold_1:84745- 85757
Transcript NameFunction/comments
Phyci_88705hypothetical protein

Sequence
1012 bases(100 bases per row)
CACGGCGCCCACCAAGATCCAGGTGGGCGCGCTGCCCCACGCGCTGGCGGGGCGCGACGTGCTGGCGGCGGCCAAGACGGGCTCCGGCAAGACGCTGGCC
TTCCTGCTGCCGGTGCTGGAGAAGCTATTCCGCCTGCGCTGGAGCGTGGAGGACGGACTCGGTGCACTCGTGATCTCGCCCACGCGCGAGCTGGCGCTGC
AGATCTTCGAGGTGCTGCGCAACGTCGGCAAGGCGCACGCGTTCTCGGCCGGCCTGGTCATCGGCGGCAAGAACTTCCGCGAGGAGCAGATCCGCCTCGT
GCGCATGAACCTGCTCATCTGCACGCCCGGAAGATTGCTGCAGCACATGGAGCAGACGCCGGCGTTCGACGCCAGCAACCTGCAGGTGCTGGTGCTGGAC
GAAGCCGACAGGATTCTGGACCTGGGCTTCCAGAAGCAGCTCACGAGCATCCTGGAGCACCTGCCGCCCGCCGGGGAGCGCCAGACCATGCTGTTCTCGG
CCACGCAGACCAAGTCCGTGAAGGATCTGGCGGCGCTCAGTCTGCGCGAGCCCGAGTACGTGGCTGTGCACGAGCACTCGGCCAATGCCACGCCCAAGGG
ACTTTCGCAGAGCTACGTGGTCACGCCGCTGGAGAGGAAGCTGGACGTGCTGCTGTCGTTCATCAAGTCGCACCTGAAGCAGAAGACGATTGTGTTCTTG
TCCACGTGCCGGCAGGTGCGCTTCGTGCACAGCGTCTTCTGTAAGCTGCAGCCTGGTATCCCGCTTTGCGCGCTGCACGGCAAGTACAAGCAGGGCAAGC
GCGTGGAGGTGTACTACGAGTTCCTGAACAAACCGGCAGCGGTTCTGTTTGCTACGGATATTGCGGCGCGTGGTCTGGATTTCCCGCAGGTCGACTGGGT
GCTGCAGCTCGACTGCCCCGAAGACTCCGCTAACTACATTCACCGCGTCGGTCGTACGGCTCGTTACAACAAGCAGGGTAAGGCCCTTATGTGCCTTGTG
CCGTCGGAGGTG