Description :
From Genome Similarity Track
Location :
contig_182:8470- 14863
Transcript NameFunction/comments
g11948.t1hypothetical protein
g11949.t1gag protein

Sequence
6393 bases(100 bases per row)
TCATAAGCGTCCACGAGGTCGGCGCAGTCCTCCGAGAGGCGGCTTCCAGACTCCCACGTGTTTTGATCCTCTGGATAACCGCGCCACTTCACCAGATACT
GGTAGTGACCGATACGCCCGCGGCGCTTCAGTATCCTCTCGACATGATAGTAGAGAGCGCCCTCATTACCAATCAGTGGGGGCGGGGGACGCCACGGACG
TGTCGACGGACCAGGACGCCTCGCGTCACTCGTCGGCGTCGTACACCTCGGCGAAAGACGTCTCGTCGGCCCGGGGGAGCCTCCTGACTGCTGTGGAGGG
CTGCCAGAGGCTGCTGGAGATGCAACGGACGGATCTTGTGTCCCTACGCGGTCGCGTGCATCTTGTCGAGTCGACTGTTGAGTCAAGACGGGACGTCCCT
CACGATTTAGGTCGTCTCGAGCGCGGAGCGCATGATCTGCAACAGCGGGTTGATGGCCTCGAGCAGGAGCTTCGTCAGGTCGCTCACCGCTGCTCGGAGA
GCGAACGAGCCCTTCAGGAGGACCGCGGTGCCCTTCGGGATCATCTTCACTGGATCCGACAGCTCTATGCCCGCGTGGGCGCACTGGAGGATCAGACCCC
TCAGAGGGCCGCTGCTCCGCCGGCTGTTCCAGCCCACCCCAAGCTGACTTGATGCAGATGATGGCGAGCGTCCTTCGGCAGTATTCGAACTCGTCGGACT
CTCAGAGTCGTCTGCCTCAGCCGGGCGATAAGGCTTGAGCAAGCCCACGTAGAACGTTGGATGCGTGGCCATGGCCGATGGCAGGTCCAGCGTGTACGCG
TTGCCGTGGACCCCAATGACCGTGAACGGCCCCACGAATCGTGGCCGAAGCTTGGTGCTGCCCACCGCAGTGACTGCCTGGATAGGAGATTCTTAGCGTT
TAAGAGGACCTGGTCCCCAAGTTTAAACACGTGCGTGTTCTTACGCCCTTGCCTGTCACTGTGTTCCTTTTGCGTGTCTTGAGCAGCCGCCATAGCGTCC
CGGACGCGCTGTCGTACTGCTTCACTTGTCTCGATGAACGTGAGGAGGTTCCGTTTGACGGACGAACGGAGGCCTTGAGGCCACGCGAATCTTCGGCGAT
AGCCTCTCCCCCACCCAAACTCGAAGCCGGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACGTAAAATGGGGTGAAACCCGTCGACGAA
TGCACAGCATTATTCAGCGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGTCTTCAGTGCAGATGCTGCGCAGTACGTCTTCCAACACTCG
GTTCACGCGCTCCGTCTGACCATCGGTCTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGACGGAACAAGTGTGTCCAAAAGTGTGAC
ACAAAGCGCGGATCTCGATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACATTATCGACGAAGAGCTGTGCCGCTTGCGGCGCCGTCACGC
TCTTCTTCACCGCGACAAGCCGCACCATCTTGCTCAGTCGGCAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAGATGAA
ATCCATGCTCACCGAGCGCCAACAGTCAGCCGGCACCGGCAAGCTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGCACGTCTCACACG
TCTGCACGTACGTGCGCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACAGACGTATACGTCTTCTCTCGGCCAAGATGCCGCTGAGCGGC
GTGTCGTGTGCCTCGTAGAGGACTCGATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCTACCTGATAGTAGAGGAGAC
CGTCCGCTAGTGAGTAGCGGTGCAACCGTGAGCGCTGCCGAGCTGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGGCGAGATC
GCCATCCTCTGCGTACGCCTCGCGTAGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGGCGCCGGGACAACGCGTCC
GCGAGGACGTTCTGCTTCCCTGGTTTGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGGGAGAGGTGGGGCGACG
ACGTCGCTGTCCGCAAAGACGCATGATCTGTGTAGATCACGAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCATCGCCAG
AAGCTCCTTGTCATGGACAGGGTAGTTCTTTTCAGCCGCCTTGAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACCTGCAAG
GGCACAGCCTATGGCGAAGTCGGATGCGTCGCATACCACACTGAAGGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGCTGCTTTTG
ATTGCCTCGAAAGCCTGCTGGGCTTCATCGTTCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTAGTTGGCGC
TGTACTTGTGTAAGTAGTTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCTGGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTCC
GCACGGACACCATCCTTGCCAAGGAAACATCCCAAGAAGGGAATCTCCTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTCTCGCGCA
TGCACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTGTCTCCTGAGGCACGACTGTGCACGAAGATATCATCAAAGTACGTCTG
TACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAATCGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGC
ATCCCGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGC
AGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTACCATACGCCA
CTTCCCATTGGGTTTACGCACGCAAAACGTCGGAGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCGTCG
ATCACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGCGTGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAG
GTAACACCGACGGTGGGTTATCGCTGACCACATCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCGACGGGTCTTTCAAAATGGCCGCGCCATATCG
TTTCTGCCGCGAGGAGGTCCTCTCGTCTTCCAACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGATCGAATCGAATTCGCGTCGGATCAGGACC
ATCTCCTCGAGCACGCCCGCCTTCAGAGAGTCGAGAAACTCGACATACGAGAGCTCTTCGAGTTCCAGTAGCTCTGCTACCGCGGGCAGAACAGCTAACT
TCCCGCCGTCCTTGTATTCGCCCGTGAGCATGTCCAATACCGTTGGTCCGACCACCCTCCGAGGGGTCTGCAATGCGGCGTCCTACGCCTGGACGTAGTC
CCGCTGTAGTTGTGCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGGTTGC
GCGAGCCCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGGTTGCGCGAGCC
CCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGGTTGCGCGAGCCCCAGCTC
TAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGGTTGCGCGAGCCCCAGCTCTAGCGTC
TTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGGTTGCGCGAGCCCCAGCTCTAGCGTCTTCTCTT
GCGTGAGCTGCCGCAGCTCGGACGCCTTGTATGCCGCCCGCCCCGTGGGCAAAGGCGACGTTCTCGTTCTTGAGAGTTCCATGAGCCTCATCCTGAGGAG
CACACAAAAATCCCATAGCTTCTCCCACACCCACCGAAGGCACATAAGCTCTCGAGGATGTAGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGACT
TCCGAAGTACCTGCAAAGTGCCGTTCGCCGCGTGGCACACGATGTTCGTGCACAAACCCGTCTCGGGAAGAGGAGGGACATGACCCGCCAGGGCTCTGTC
CGCGAGGGGTTTGTGACTAGCACCGATGGTGCGACTTCGCCAATCAATCCATGGCTCATGTTTAGTAAGCCAAGGCATGCCTAGGATAAGATCGTATCGA
TCATCCATGTCGAGGACAATGAACGGTTCGACCGAATTGAAGTCGTCAAACTTGACGTTTAGAGATAGTAGAACCTTCCGTGTAGACACGATGGATCCAG
TCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTAGCATACAATGCACTGTTCCTAGCCACACTGGACTTCGTCGCGAAGTT
GTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTAACGCTGGCTGTGACAACCACGAGGTTGGACCGCGCGGCGGCCACGGAG
AGACACAGAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCAGAGCTACCGACCTCGAGGAGGAGCGATGTCTCCCAGCAGGGCGTCCCG
CACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGTGACGGAGCGGCCTTGCCGCGGCCCGTCTTCCACGGATTCGTTGGGCAG
TTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGCGTTGATTGCGCTGGGGACGAGCCGACTCGGCCGACGAGATCTCCATAG
GAGTGGGATCTTCCGTCGCCTCTGCGCGACCCGCATAACCCTGCGCCGAGCGCACGCAATGATCTTCCAGCATGGCGATGTGCACGGCATCGTTGAACGT
CGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGGCCCGGACGGACGCCATCCATGAAGACCGTCACCTTAACGTCCTCAGAGAGGGGAGCACCTGCC
ATGGCAGCTTCGAGATTCTGCAGCTCCATGACATAGTCTTGAAGCGTGCGCTTTCCTTGCTTGCACCGCAAAAAGAGTGACCGGTAACGGTAGGCCACAT
TGGCCAGAAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAAATACCCAGGAGACGAAGTCTCTCGTGCCATCGCCCATGCGCGTGC
ACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACTCGTAGATCTGCCCAGCGCTCAGCGCTATCTCGATCTCACGAATCCAGAAGACA
AGACTGTCTGCTTCTTTGCCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCCTTGCCGTGCGGCGTATGAAGCAGGACCCGAGGGGTTCG
CCTGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGTGCGAGCAGCTTCCTGTGCTGCAGTACTCACGTGAGCAATCAGCGACGATTCGTACTTGTCGAA
GCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGGAGGTTGGGGAATCCAGCAAACGCTGCTTCGCCCAGGAGACTGACCATCTTTTCTAGCGTAGCCCAG
TGGGCATCTGAAAGATGAGGAAAATCCTGCCGGGACGGCAGCCTGCTCTCTGAGTCTTCCATCCTCAGAGATCTTGATTGTAGCGATCCGCGCCGGTCGC
GGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGTCACACGCACCTTAGCCTTAGAGGAAGCGTTAACGCGCTAACCACAACAGACGCCTGGCGTCTCT
GTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGAGTACCAAACGACTTGCGAACTTCCAGGTTAGAGTTAAACTGTCTGTATTAATCTCA