Description :
From Genome Similarity Track
Location :
Scaffold_1051:847- 6606
Sequence
5759 bases(100 bases per row)
GGTCTCGCCAGTGGGCCAGACGGCCACAGGCTATTCCGACACACCCTGCAGCAAAACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGA
GAGCGCCCGTGCCACAAGTGCAAGTGCTTCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATAATGAGTTCGACCC
AGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCC
ATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGTCCCTCATGAGAGATCAAGCGT
CGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGA
TTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGATGGCACGAAAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAA
TACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGA
CGGTGGGAGACGTGAATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACA
CCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCGACCAAGTCACGGCGCCCGAC
TCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCAACGACCGAACGGCGAAGACAGGAG
TCAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGTCTTCATGGACGGGGCAGCACAAGTCAGGTGATCACAGTGCGG
ATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGC
GGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAAAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGC
CAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGCTCTAGGTACTGCATTTATGCATTTGTGAACAAG
ACATCGCTAGATCCAGGTAGCAGGAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCC
AGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTG
AGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGAATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATA
CTGGAAGTACCATGCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGG
TGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGGATTGGTGAAGGCGTGAACCGTA
CGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGCCAAGATGCCATCCTCGG
GATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGAACGGCGGCCG
TTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAAC
ATGAGAAACGGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCGCAATACCTCCAGGTCATGAACGTCAGCGACAA
GAGACTATTACTGGACCACTATGAAGAGATCGGACGATGGTTGGCGAAGGATAGTATCCCTAAGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTAC
AGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGAGGGGTCCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGC
CTTCATACCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCG
GCCCTTAGATAACGCAGGGTCGGTGAATAAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTG
GAGAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAATCGTCGGGTTTAAGCTCGTTAGAGGACCGACTAGATCCGACCGGTGACT
TTCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACCGA
AGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGACCCCGGAGGTACCACTGACCACAGAAGAG
GTCACGATTGATGATATCCAAGTGGATCCAGGGACGAATGAAGCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTG
GTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGCGGCGCC
TCAGTTCCGAGAAAAACTATCGGATCTAATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTTAACGTCCCCGTGGGCATCCCCAGCGGTATTCATC
ATCAAGAAGAACGGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGTCTCTAATCAATGAG
CTGTTGGAAGATCTGGATAAAGTACTCTGGTACGGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCG
CATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAGCGTCTAATCGATAACGCCCTCTA
TGGATTCACCGGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAAATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACC
CCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGT
GTACTATAGGGGAATCTCTCTATCAGTGTGGGAAAGAGCTATTGAGGAATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCTAAGGAGGGATTGGAGA
CGAATCCTAAGGACCTGTCTTCGTTAGACGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTATTACAGTCGGTT
CATCGAGGATTACGCCCTGTTTGCCGCGGTATTTTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAA
GCTCTGGCCCGGGAGATGTCGGGTCCACGAAGGGATCCAAGTGGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGA
GAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAG
GATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAA
GAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCC
TGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTT
ACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTAGACGCTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCCTGGTAGTCTTGGCC
GCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAAAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTAC
AGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATG
GGAAGTACTACGGGCCAGATCCACTTATGCGGAAGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAG
ATCCGAAAAGGCTGGTGATTTGTGGGGGATTCAATTTGGGGGATCAGACAGGTGCGAGGTGAGATTGACTGCAAAGGCCCCGGCCCTAACACTGTTACGG
CAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAAATAGTTTGGCCAGCGCCGCTT
TACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAA
AAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCAAGGAAACATTTGTGAAGAGAGTCCGCATCGAG
CGGATCATCAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTA
CAGCATTATCGCTACGGATTACGCGGTGGATCTGTATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGA
CTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCC
GGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAAACGGTATGTCGGGGAATG