Description :
From Genome Similarity Track
Location :
Scaffold_70:8466- 9649
Sequence
1183 bases(100 bases per row)
GATACAAAGCGCGACTTGTCATCCAAGGACACACTCAGGTCCAAGGAGTCGACTTCGAGGAGAGTTACTCCCCAGTCATCGCAAAGGAAATTCTGCGATT
GATGCTTACTCTCGGCGCGGTCCTCGATTATGAGATCGACGCGATGGACGTCATCACAGCCTTTCTCAATGGAGAAATCGACTGTGAAGTATACGTCAAA
CATCCTCCAGGATTTGGCACCGCCAAGCGTCCTCGCGGCGTACTTCAAGTACTTCGAAGCGTCTACGGCCTGAAACAGACACCACGCGTGTGGTTCCAGA
CACTGGCTACCTACTTGCGCGAGCAAGGGTACACCCAACTTGTCAAAGACAGGTGTGACTTCACAAAGGTTATGAACGGACGATCCGTTTACATCGGCGT
ACATGGCCTGTCGGCGCGTTTTAAAATGCACGACCTTGGCCACTCAAGTTCATTCTTGGGTTCCACATCGTTCGAGACCGTTCGCAACGTACTCTCACGA
TGTATCAATCCCAATATGCGACCACTATTCTCAAGAGGTTCAGCATGGAGAATTCCAAACCTTCACCCACTCCCATGGAGGTGAACCTCAAACTCTCTGA
GTCGATGTGTCCTCAGGACGAAACTGAGCGCACCTACATGGTGGACAAGCCGTACCGATCTGTCGTCGGGAGCATCATGTACCTCATGATTAGCACCCGA
CCAGATTTGGCTTACGTCGTCCAGCAGCTCAGTCAGTTCTTAACGAACCCCGGCCCAGCCCATTGGCAGGCAGCCAAGCGAGCACTTCGCTATATTCGAG
GCACGATCGACTACGGTCTCGTCTTGGGTGGTGAACACAATGTCACCACTCCGCTGCACGCATTTGCTGACAGTGACTACGTTAATTTCGTTGACACTCG
TCGCTGCGTCGCCGGCTTTGTGACATTCTACTGCAACTCTGCGATCTCATGGATCGCTAAGAGACTACGCAGCGTAGTTCTCTCGACCACCGAGGCAGAA
CTTATGATTCTGTGCACAGTAGCACAAGAATGCTTGTACGTCAAGCAGACAGCATGTGAGATGGGTCATCCCATCACCTCGGCTATCACCCTCCATGAGG
ACAATCAAAGCACCATCAAGATAGTGAACAACTCTGGTCACCATGGGCGCACCAAGCATATTGATGTGCGCTACCATTTCATC