Description :
From Genome Similarity Track
Location :
Scaffold_144:84636- 86225
Transcript NameFunction/comments
g18455.t1ETP48319.1 hypothetical protein F442_05897 [Phytophthora parasitica P10297

Sequence
1589 bases(100 bases per row)
TCATCGCCCAACACGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTGAACTGCGGCTTAAATTCCACGGCGTACGGCTCGATGATACTTT
TACTGTCGTCGTGGGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTCCAGCTCGTCGTACGTGCGCTTGGTGGCCTCCATGAACTT
CTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGACTGCACCAGCTCCGTGTCCACGATGTTGATGCCGATCTCCGTGTCACTC
GTCATGCTGCAGCGGTTTCAGTTGGCCGAGCCCAGGGACACGTACACGTCGTCCACGATCACCAGCTTGCTGTGGATGTACAGCTCCTTGGACTCCTTGG
TCGAGTACAGCTTGAATTTGTCCGGGTACGCTTCCTGGATGGGAGATACCATGTCGTACAGGTACTTGGCGTAACCCGTGTACTCGGCTTCAACAGTGCG
CTGCATGATCACGATGAGGCGCTCAATGCTGGGCATCATGTCCATGATGGCCTCCAGCAGCTCCGGCACGAGAATGAAGTACTGGTCCTGGATGAAGATG
TAGTTCTGCGCGTTCCGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCTCGCCTTGCGGCGCGAAGCCGTAGTGTTCGTAGTCTGGGCTGAAGGTGC
GGCATAGCTGCACGGCGTGCGTTCCATCTTGGGGAATTTCCAAGGGAACGTCAGATTCATCGATAGGGGGCAATTTCGAGTAGTCTGGGTTCTCGAAGTC
AAGCACGTCGTCAACTAGATCCTGTGACGGCTTGGGATCGGCATTCCACCGGTCCAAAAAGTTGGCCGCAACGTCCTTGGAGGCCGGACCCACAACGCGA
GCATGAGCGTCCAACCAGCCGTTCCACAGACACTTGATGCCCGTCCGTTCACGCAGCTCGGCCTGGTCGTGCTCGACTGTGTCCCAGCGGTCGTTGGTCA
GATCCACGCCGCCCACGTAGGCCACGAGGTCATGGCCTCTACGGACAATCACCGACTTCTGGTGGTGCGACGATGTGGGGAACGGCAGGCGATCATCGTA
CACGAAGCGCGCAGGTCCGTACTGTTCGGGTGGAGGCAGCGCGTTGATGAGGTCGCGCACCTCGTGGTTCTGCGCACGCTCCGTGAGATTGGACCACACG
AGCATGCGCCAGTCAGCGCCGCGCTTCACGGCACCCTCCGCTAGGTCGCAGAGTTTGGTATCAGGCTCGAGCGGCTTGAACGGCACGTTGCATGTGCCCC
AGCCCGCGAGGTACACGAGGTCTCCGCGGCGCACCTCCATCATATCGTTGGCCACGTCATTGAAGTAACCAGCAGAGGCGACGTAGAGCTTGACGCGGTT
ACCGGTCGAGTAGAGCTGAATGCCGTCACGCTGATGACCAGCACGGGACGTGAGCATTTCGCCTTCAGTGAGAAACCAGCGCGTGGGCTCGAGGTAGGGC
TGGTCGAAGGGCGCGGTGGCATCTTTCTCGGCTTTTTGCTTGAGATGGAACGGGTCGACGATGAACTCGAAGGCGCGGCTCAATCCTTC