Description :
From Genome Similarity Track
Location :
Scaffold_382:8463- 20695
Transcript NameFunction/comments
Phypl_g7671hypothetical protein
Phypl_g7672hypothetical protein
Phypl_g7673hypothetical protein PHYSODRAFT_353708
Phypl_g7674DEAD/DEAH box RNA helicase, putative

Sequence
12232 bases(100 bases per row)
ACGGTCGTTTTGCCAAAGGACGTTGGCCTGCCAAGGATCGCGCAAGGATCACTAGGCATTGTCgacaagatgctgcaggagagcCTAGGTGTCGGAGGCG
AGTCTGCCGTTAGCGTAAAGAGAGCTCTCGTTCAagcgcagaagctgctgcagcttgcttCTGTCAGACCCAATGCATTGACCCTGCGTGAATATCGTGA
GGGGTTGGAGGTAACAGCGTTATAACCACGGTTCCCTAGAGCTATTACAGCGAACGACCTCTAATCTTTTGATTGACACTATGCGCCACTTGTTCACACA
CAGGAGTGCTTGAAGGCGGAGGGCAGCACCGCCATGAAAGTTATCGGGTTCCAACTCGCTGGAACTGCTCCTGGATGTTCCACACACGAAGTCTGGATAT
TTATCCTAGAAGCGGTCGTGACAGAGCTCGGTAGTTCCGATAATCCGTCAGCTTTGgccgctgcagttccagTGCTCGGACAAATTCCAGTGCCTCTTGT
GCTCAGTTTCTTGCTGTCTCGTGAAAGGGAGCCTATGAACAAGCTGCGCACAATTTTGACTcacgaagacgtcgaggtTCGCTGCGGCGCTATTGAGACG
CTGTCGAAGTTAATGCTTGGCGTGGCGATCGATGTCGCTGGAGACGGACTGTTCGTTTTCCCATTCGAGTCGCACGAAGCACGAATTTGTTGCCAGCAAG
ATCTGGAGACGATGGTAAACGATTGTTGGAAGCTCATTTTTCACACTCTTTCATTCGATGGACGGTCTCAAAGTGCGGTGTGGGCTGCGGGTACCGCGTT
CACAGCCTTAGCGGGTCTGTTTGCGCGTTCCAGCTCGATGACACCATTTTTTTCAAGTATTCGAGAATCTATCCGCGCTCAAGCACCTATAGACGAAGTC
GCCTCCATGATCTACAAGCAAGCATTCCCGCGAATTCGAGCACTAATAGCTGTAGCACGCGCACTAcccacgaagcagcagcctgATGCCATGCTGTGGA
TCTCTATGCTGCTTTACACGATGATGGAGCGCAGTGGGGCGCGATGTCCAAGTGTGAGTGTGCCGTACATGGACATCGATTGTGAAGATACCAACGCCGA
CGGTgcagacgacgatgatgagCCTCATGCTTCCACGGAGCCTGTTCGAATTGATGATCTTGTGAGTGACCTACTCGAATCCTGGGCGTTTCCCACGATA
TCGAGACGTGTATCATTGGCACATGCTAGTAGTATGTGCCGAGCTATCTTCATTCTGTTGGCGCACCCCTTACAGACATTCACGCGTATGCGCTGGGCTG
CTCAGCTCGCCAACCACCTCATCGCACAGTGCTATCTTGCCAATAAGACTAGCAGTAACAGCAACGCTGCAACTAGTCCCGAGCTCAAACACGAGCTTTG
TGTGATGCTGGTGAAAACATTTGCCTGGCTGTCTGGCGTCAACTGCCAGTCTCTCTTCGTTCGTACAACCGAAGCACTTTACCTCGTGGATCAGGAAAAG
GATCGACGTGATCTCGTACAGACTCTCATGGATACGATCGCCGAGCACGTCACCGCTAACCGGGACTTTCAACTGCTTCAAGGATTGTGTACAATGGCGT
TCTTCAGACAGCCAAAGGGATTCTCAAGACTGTCACCACGCACCAATGGCTCGGAAGTGTTCCGAGCACTCTTTCAAGCTCTCGCTAATACGACAGAGCT
GCACTCACCACCTCGACGAGGAGTCGTCGAGCATCAAATTTCTCAGCTCATTGCTTTGAGAGTATTTCGAGGACTACTGCTACTGAAGTTGGGTGGGTCA
GCTACTACTTCCCCCAAAGCGTATCGGCGATCCTGCGAGATCAGCGAGAACATTGTTTACTACACGGGCTTACTAACGTCACACTTTCAAAGCATGCTTG
TCTGCCCCGAGTTAGCCCTTCGTGAGTCGATCGAATTTTTTCAGCAAGAGCTGTTCCCAAGCATGGATCAGATTGCGTCCCAATGCGGCCGCCTCCAGAT
CCTTTGGATTGGcgttcgtcttcatcgcaATTACGCTTCGCACGTACCTTTCGAAGCTCTGGTGCGAGAGCTCCAGCGTGAGACTGGCCGGCTGTTCACC
GCTATCTGgaatgacgacgatgacatgGAGGGAGCAACTTTTGACAATGGCTTGCTTGGCTGTGGTGGAGCTAGTGCAGAGGAAACGCCTGCCAGTCGTA
AACGTGCGGGTGATGCCAACAACGTCGACGCCCTGATGGTACTTGGCGACTGCATTACGCTGTTAGCGCAGCTTCAGCCCCACACGCAGCCCCAGTTTCT
GCAGATGTGCGAGAAAATGATCGCCGCACTATTGGTATCAGGGAGCGTCCCAGCGATAACGTCCCAGCAGTATCGTGTGTACGTTTCTCCATTCTGATGG
AATAGCTTACTACTGGCTTGGCTAATCACGATTTTGTGTTTGTCTAGCATCGAGGATGTAATGGCGCTCCTCTCGACCCCCGTACGAACAAATCCAACGT
CGGAACCAGAAGCACAGCTCTTGAAAGGGATATTTGACCCAGAGGACATCTTCCTCCCACGGAAGCACTTTGGCGAAAATGGCGAAGCTGGTCACACAGT
AAACCCACAAGACGATGAATATCGGGAGCCGATGACGGTCACGGGTAGTGCTGACCCTGTCTCCGTCCAGATTTCACACCACCACCCGCTGTCAGGAAAG
GAAGAGGTGGTTGCACTCGAcgtcagctgctgcaatgTCACTACTTGGGCGTTGAACGATCTGGAAATTCACCTTCGGCCGCTTGGAGGTGTCGGTGTTG
TTCAGTGCATTGATGCATCAAAGGATTTAAAGCTGCGTTTGCTCCGTGCTGGCGAGACCGTTAGCGTCGACACAAGCGGAGGCAGTACCAGTTTACCACC
ATTTGGCGTGATCAAAGCGCAGAAGCAGTTCCGCGTATGCAAGTTCACGCAGGCTTCCTTTCTGGTGCAAGCAGTGCTTGCCCAGGAACCCAGCCAAGAT
GTCGACGATATGGGCGGCAACCCTGCCGAGGAGGCCTCTCCGACTCCTATCCGTCTTGCATTTAGTAACCGGTACATGCTGCATTTCGACACGCTGCTAC
GACCCCCACAGCCTCAATTTGTGACTGCTGCATTCTTCCAGCATTACTGGCAGAGGTACGACCTGCTAATCGTCATTGTTGCAATTCCCCCTTTATGCTA
ACTTCTTGATGTTCTTCATCACCCCCAACCGTGTTTCTGTTTCTAGTGCCAACTCGGGAGTGTCGTGGCATGTCAAGGCGCAGGAATCGCATGGAGGCAA
ACTTGGGGTTTGCCAGCGCGTACTCCACGTCATGAATACCAAGATCGGAGCTGTTTCCGAGCTGTTTCTCGAACTACCGATGCACTTTCACGTACGTCTG
ACCGCCCCACCACCCTCCTCTATAGTTTATAGTTGTGGGTCAGGCGCTTACTCACCCACTCACTCTTCAATGTTTTAGATTGCGATGCTCACTCAGACGC
GATGGGGTTCCTATGTGGTCGCGACCCTGACAATGAGTCGCCAGGCGGACTCTGGTTGGTCGGGTGTTCTGGAAGTCCGGTCAACGCGTGAAAACATCCG
TGAGTTCGAGAAATGGCCGAAGGATACTGGCCATCTCTTTTGTGGTAGCCACGTGCAGATCTGCAACCCAGCAGCTACTCCATCCATCGCTCCCGAAAAC
ACGGAGGTACCCACCCCACTCAGCAGCGCTGTCGACGCTCCGACCTCCTTGTCAGCGGCATCATCTCCATTCGACAACACATCTTCGACCCCAGTCCGTG
CTCCAATGGAGTCCGTCGCGCGTGAAAACGGAGCATCTGCGGAAGAACCGCCTGCGACCACGGCCGCCTCGATGTTCGCGCCGGACGtgcgctccaccac
cagcttccaCAAAGACGTGAGCGTCGCTACCGACCGCATGTCCTCGTTCGCgcgcagcatccagcagccGGAGCAAACGCGAGCGCCCGAGGCCACCCCG
CCCCCCGACGAGCAGTGGGGCAACTTTCTCTaggccacttcaacttgatgTATGGACCACCAACTTCGGTGGTCGTAAGATCTGAACCCACTTCGCATTG
GTCAAAACTCGAGTTAAAAATCATCGCATCAGATCTAAGATGCGGCCGGTGCGCGGAGCCTCGGGCGCGGCTctgggcgacgaggacgcggagaaggagc
gcgtgTACCGcccgctgctgttccagtccACGGGCTACGCGTCCTCGGAGCTCTTCCGCGACTCGTACGAGATGCACTCACGGCTGCCGACCGCGTCCTC
GACCGCGCCTCTATTAGGGGTagaggctgctgccaccgattTGTCTGAGAATCAGAAAGTAAAACATGTATTCGAGCCACAGATCCGACTCGAGACGCTG
TCGTCAAGAGCTGCTACAGCTGTGCTGTGGGTAACGTACCTAGCGTTCTTGCTAGCGATGGCGCTCCCGTATCTGCAGAGCAAAGGGTACCTGGAAACGG
TGCGGAGGTGATAGAGGAATCAGAGTTTTGTTTAATTTTCTGATTCTGATTCTGGACTTCAACTTTAGGCGGTGGAGTTACCAGGGGCAGTTTGTACGGA
TGAAGTGAGGCGTGAGCCGTGCATTAAAGTTGACACGACGAGGAACGTTGCTCAGTGGGCAGCTTACGTGGCCAATGTGTCGAGGTATACTGGGTCTATT
GAGATCAAGCTCGATGTTCGAGAGCAGGTGAATACTTCAACGTTGTCGgggttgctgtcgtcgctggaggagagTAACACTTTTCAGGAGCTGGAACGTG
TGGGGACTGCGTGGAACATGAACCGGGATGCAAACAGAGTGGAGGGCAATTTAGAGGACGAAGCATCGAACATCTCCGAGCTTGAGGATGGGGAGGTTGA
CCAAGACGCAGGATATGTGTTGATGTACGATGCCAGGCTGTATGGCATCGACCTTGATGTGACACCCGCCGCAAAAATTCTCGTTGCTGATGAGCGAAAT
CAGAGCGTTTGGGTAGAGTGTCGATCAGGCGGACCATGCGAAGTTGTGAGGCTGCTGGAGATTACTCAAGACGTCGACAGATTGGTAAGGGTAAATGTGC
ATGATGAATGGTACTTGTGTGGACTCACGTGCGATGTATCATAATATGATTGTGCAGGGTGGGAGTGGCTACGATGCGTACTTTGCTGTTGTGACATTTA
GAGGGTTGTATCCGAATGTGTTCGGCAAGGACGTGTTCTATCAGCTGGCGTATACGTACGTACTTTTGTCTGATGCCTACTCGTCCTTTGTATTTGCAGG
TTTGAGGTCTAAGTTCTCTACTCGTCACTTTTTTGTCCTGCAGGAAGCCTGTTATTCACGTCGGTGAAGTTATTGTACGTGGTATACTGGTGCTGGCATC
TATTTTGGCACTTCCTTGCTGGTTCATTTCGGTGTTGAATTTCCACGACGGATCATGGAGCCAAGTACTTACAGTGCAAAAGTGGCTGCTGGGCATTGgt
gtcgtgctcgtgctttGGCAGAATCCAGTGTACGCAGTATCTGAACTCTACACCACTGTGAGCTTACGAACTCGATTTGTATCGATCACATGCCAGTCAT
TCGCGGAGGCCTTCTTCTACGTATTTTGGTTGAGCCTTTTGGATCAGCACAGCGGAGATTTTTCCTCTCGGAGATGCTCATTTGCTACGAAGCTCGTTTT
TGGCTTGGTACTCTTTGCTGTAGATACGGGTATGACTGTGCTACGAATGCCCAAACTGTTCCTCGGTGTGGAAGCGGCATCAATCGCGCATGATTTTCAC
CACGAAGAGCTCTACGTACTTCTTGGCTTTATTCGTACGGGTTTGGTGTTGTTTTGGCTCGTGTGGACCATGGCAGTTGGAGCAAGATCGGGCCGGCATT
TGAAGGCACTGCCGTACATGGCAACTCGCTTCAAGCAACTGTCGTATCGATACCTCGTACTCGAGACACTTCTCATTTTCGTCTACGTATTTATACTCTC
AGCTCTCCAGATATTTTATCTGACCCAAACGTGGTACTTCGTTGGCTACGATGCATTCATCCAAGACTCAGTGCACACATTCGCTAAGATGCACACTGGG
CACCCATCGCTGGGCAAGTTCGTGTTCTTGTCGGTGTATGTCTATTTAGTCATGTTTGTGCACTTGCCTCCACTTGCGGGCGGTAGTACCGGCTTGCTGG
CGTCCACAGCTTTCCACGTTGACGAAAAACCACGCGTGGACTCGTACGGCTTCCTTACTCCCGATTCAAATTTATTTTGTGTGGAAACAGCTGGATGGTT
ACTGGAGTTGGCGTATCAAGCTTACTTCGATCCACCTGGATGCCCATCCTCGTCTGGATATGGTGAACTCACTCTTGAACGATATGGTTTTGAGTTGATC
ACTCACCTGCGAAGCAACCTCACTGATACccacgttgtcgtcgctTGGAGTCAAGAGGACCACCAGCGCTTGGTCATATCATTCCGAGGCACAACCAGCA
AGGAAAACTGGAAGAGCAATCTCCGAGCTGACCAAAAGGTACTTTGGATAAAATCTCGAGGTCTGCGCTGGAGAAAGTCTTGTCTTGAAAAAATGAAAGA
TGTTGCAGCAAAGATCCCGCTACTTAACATGGCGCTGCCGAGGGTGCATCGAGGTAATTGCTCCTGATCCACCAATGTAGCTGCTTTCTCTTTTTCAGGA
AGATGATCAGCTAACCTTTTGTATTGTTGTTGTGCAGGGTTTTGGATTGCGTACGAGTCGATCCGAGATGAGCTAAAGGAGGTGACACGGCTCATTCTAG
ACGAAAATCCCGGTGTGTCGGTGTATATCACCGGCCACAGCATGGGTGGGGCACTTGCGGTTATAGCCGCATATGACCTTGCTGTAAATTTCAGCATCAA
AGTTAACATGTATAACTTCGGTGGCCCTCGCGTCGGCAATCCAAGCTTCCGTCAGCACTACGACAGCTGTGTCCCCACGAACTATCGAGTTGTCATGGAT
GGCGACATCGTTCCGGGGTGGCCAAAATTTGTGCGTTTGCGTGCTCTGCTGTTgtaggggggggggggggggtactGACGCCTTGTTTTTTTTATTGACG
TGGCCGCAGTGGGGGCTATACCAGCACGTGGGAACTGAAATCTCACTCGATGTCGCGGGAAACCTGATTGTTGACCCGAGCTTCGTAGAGCGGCACCTCC
ACAATTCGTCAAGGCGCAAGACCACAATGCACGGCACCAACGTATATCGTGTGTCGATTGCCAAGTGCCTCGAAAATCTAACAGCGTCATAGCAAATGCG
CGGAATCGGCGTATGATGCACTAATCTATCTATTTGCACCAGTTCCCTCGCTTTGTTGTGGGAGGAAGTATCCCATGCCACGAACCGTCGCAATCCGTTT
TACACAGTGTGAATCACACTACGAGGCGCAGTGACTGCAGAGCTCTTCGATATCTAaggcgcagctcaagcatCACTATGTCAGATGGAGACCAGCAGGC
CCAGGAAGGAGTGATTCGCTCGCACATTGACCTTGCGGAGGCAGCGGCGAACGGCTCCCGTGCAATGGTATGTGCGTCGAGTTTACATCGTCTGCAGTAT
GCGGCACATTTTGTTAAAGAGGCTCTCATGTTCACTGGACAGGTTGAGTTTCTGCTGGACAGCGGCGTGCACATTGATACACCTGGAAAAGGTTGGTTCT
TGCCACAGGACCCCCTACGTGATGCACAGAGCTGACACTGTGCTTTTATTGATTGCCAGATGGAACGACGCCGCTATGCGCTTCTGCTCTGTGGGGAAAT
GATACCATGGTCACATACTTGCTCGACAAAGGTGCCGATGTATCTGCCAGAAACGAAGGTAAACTGCACCACCTTCTGCTTAAGTCTTGTGTGCAGCGAT
GTTGTGTCCGTAGGCATGAACTGGATTTATTGTTATCGACAGGAACGGGATGGACAGCTCTGCACGCGGCCTCGTTTCAAGAGCACGGGAAGGTCGTGCG
CATTCTGTTGGCTCACCAAGCGGACCCGAAGATGGTCGACGTGGAAGGCCGAAGAGCAGTGGACTACGCCAGCATCTCGGAGGCGATTTGGCCCTTTTTC
TCCGGTAAGCCCCTTGACGACGAAAGTACTGTTTACATTCTGACAATGCGAAATTTCCCTTCTCTGTCCTGTTGCCCTGCCTCCTTCAGCGCAAGGCTGC
ACCAAGAGTCTCAAGTCGGATCTAGTTGCCAAAGGGGTCATCCGCAAAATCCCGGACCAGCCCGAGCAGACCCAGTCGAGCGACAAATACGACAGCGTAC
GTCCTGCATAGCAGCAACTCTAGAACGAGTGAGCGCTAACCCCTCCGCCCGATGCTGGCTACGTGCAgatctcgtccttctcgcgcCCTGGATCCGCCTA
CACGAGGGCGCAGATGCACCCGCCACTCGCTCGCCGACAGAGTCCCGCCATCAAGGTGAGCTCCGCTGCCGCAGTCAGCACTTCGCTTGGTTAGCGGCTA
ACTAGCAGGTTTTTCTCCCTTGCAGTCCCGCGACGGCCGCATCCTGACGGGGCCCATTGACCCGCTCGGCGACATGCCCGCCGAGCCCGAGTCGAACCAG
CGGCGCCCGTCCCTGAAGCGCATGGGCATCTAGGCCGGAAAAAGCACGCTCTGAAGTAACAGTGTCTTTTCGACCAATGAAAGCGTCCGCCGCATAAAAA
GAAGGTATGCTATATCTAAGGCGTTAGTTACTGTATTCTGTTGCTCAGGTTGTGCGCCATAGAAAAGTGGCCCGTGTCCTGGCCGCTCGTTTGGCGCCCC
CCTCGGCCGCTCAGTTCTTGTATCGcttcgccgccagcacgtcgctccGTAATGGTGAGTCCTGCACCGCCGGAAGCGTGCCACAAACCGGCAAGAGCCG
CCTATAGATTGATCGCTAACCCCCCCTCTCTCCTCTCCCTCGTCTGATGCCGCCCCGCAGTCGCTTCTTAACAAGGGATCGCGCCTCATGACCCAGTCGC
TCCGCGCTGGCGCCCGCGGCATGTCGAGCGCCaccgagcaggaggccaaggagcagaTGCACCGATGGAACACGATCTCGAAGGGAATGATCGGCCTGTC
GGCGGTGTACACGGTGTACGCCATCAGCGACCACCTGagccacgagcaccacgacgaggagaagcccgCCTACCCGTACCTCAAGATGCGCACCAAGCCC
TTCCCGTGGCCCGAGTCGGACTGCGACCTCCTGGACACGGAGTGCCGCCGCAAGGCCCGTGAGGCCAAGAAGGCTCTGGAGTAAGCGGTCTCAACGGGGA
CTCAGATCAGacgcaggtgcaggtgcaAGTGGGTGGGGGGTGATATGTCAGCCTCACCCTTCTTTTCGCGGTCTACCCGACCTACTGCCTGTTGGTGTCT
TCGCTCTGACTGCTGCAATTCCTATTCGCTCGGAACTTGAAAACTCCGCACTCGCACACACAActgaagaaaaaaaaaaaaaaaaaacacgaAACggagt
cttcgtcgtcgttaTTAACCCCAATATCGAGTGCGTTCCCGCTACTTGGTCCTTTATCGAGGGATTCACCACTATGATAATACCATTCTCATCAGCAGAT
GCCGCCTGCTCGGTGCTCTTGGTGTCGTCCATGCGGCTGCATCGCCAGTATTGATTCCGCGGTATTGCTGCCTGAAGTAGGCGCAGGACGTAAAGCTAGA
GTGGACCACCCACAGAATATCGTTACTTCACCATAACAGGAGCTCTTCGCTGGGCAAAAATGGCGGAcacctcgtccgtcgtgaagcgcagcgccaccca
GCGCCAGCCGCAGCCTGGCGAGCCCGTGTGCGTGGTAAGACGGCTCCATGTGCATAGCACACTAACCCTAGTACAATGTTCTAATGCAAATCTTGCCGAT
ACACCTCAGATCTGCGGTCGATACGGCGAGTTCGTGTGCGACGCCACGGACGAAGACGTCTGCAGTCTCGAGTGCCGCGACGTCTGCATAGCCAGACGCC
AGCCGAGAATCCAAGAGGACGCACAACAAGCCGAGCGGTCTGACGAACTTCGACGCCAATTGGGCATCCAAATCTCATCTGGATCGGCGTCGAAGGCGGG
TCACAGTGACAATGGAGCACAGCGATGGCCCGTTCCGTTCGTGGACTTTGCACAGGAGCAGGAAAGCGTGCAATTGCCCAATCAATTGTTGGTGAATCTC
AGTGCCAATGGCTTTGAGAGGCCGACGCCCGTGCAGATGCAGACTGTCCCTTGTGTGCTAAAGGGACACAACGTACGTGGGTTAGTCTTTGAAGACGAGA
AGAGGGAGAAGAGGTACTGACAATTGCTTCGTTTTATTTTGTTTTACTCTAGGTGTTGGTGAGTGCCCCCACTGGGACGGGCAAGACGGCGTCGTACTTG
ATCCCAGCGATTGCACAGGTTTTGCTTGCACgggaagaggagaaggaggaggttttggcgttggtgctggctCCTGTTCGAGAGCTGGTGATTCAGATTG
AGACGGTGGCGAAAAGGTTGATGCGCGGTATCGAGGATATGAAGACGGCCTTGTTGGTGGGAGGGTTCCCCGTTCCTACCCAGCGCTATCGACTTCAAGG
TGGAGTGCAGCTTATTGTGGCAACACCGGGTCGCTTTCTCGATATCTTTACCAACTACAACGGTGGCGATGCCATCCTGCCGGCTATTCGCACGTGTGTG
GTTGACGAAGTGGATATCATGCTGGACGTTGGCTTTCGATCTCAGATTTCTCAAATTGTGGCGTCTTTGGTGGCTCTAGCTGGGGGCCGCCCCAAGGGCA
TCCAAATGCTGTTCTTCAGCGCTACAGTTTCAGAGGAAGTTGAAGCATTGGTAAGACAGATTTTGAGGGCCCCAAAAAGCGAACAAGCTTATATTCGCAT
CGATGTTCGTGGTGTGGAGAGCAAGGCAAGGGTGGCGAGCTTTACGTTGAATCTAagcgttgagcagcaggttcgATGGTCAGAAAACAAAGCAAAGAAG
AACGAGTTGTTCGAATTCTTGAAAGGGAAAGGCGAAGAATCAACGGTGGGTGGAATGTCGGTCACTTTGTGCAAACCCTATTCGTTTCTAGTTACTTACT
GATAATGTCTGTTGCTCCTGCTGTAGCTTATCTTTGTCGGGTCGAAAATTGGCGCTACGATGCTCGCAGAAGCGATTGAAAAGCGGTGTGGGATCGGCGC
AGCTGCGATTCACGCAGATAAAACCCAGCAAGAAAGACTCCGTCTGCTAGAGTCCTTTGTGAAGCTGGAGGTCCCTGTTCTCGTGTCGACAAATCTGCTG
AGCCGAGGAATGGACCTATTGAACGTTGAAAACGTGGTGGTATATGACTTCCCCAAGAAAATCGCGGATTACGTTCACCTCGTTGGTCGAACTGGACGTG
GTGACGATTCGTTCGGGAATGCTCTTACGTTCGTGAATGAGGAGGACCACTCACTTTTCCGGGAGCTTGTTCCTTTGTTGCGCAAAGCTAAAGTGTCAGT
GCCTCGAGAAGTGTATCAGAGTATTCACTCGGAGAATGCCAAACAGCGTGCTCGCTCCAGCGAAATCGTGATCGATGAATCCAGACGGGCTTTCCGAATT
CGAGAAACACTGATAGACGAAATGGGCACAATAGCTTCGGAGTGGAAGGAATGGGGGTGCCACAACAACAAACGGCGACGGACAGGACCGTGACCACCGG
TCGAAACCTTAAACTTGTGACTTACCAGACGAGTCTTAGTGCACCGGGTCAAGCGCAGAGAATGTGGGGCCACGATTATCGCTGAGTGAAGCAGGTGCTA
TTCAGTCTTGTCGGTGGCTCGGTCGCGTGCTTTGTCATTGTTCGGCTTTATTGCTCCTCTTTTGGGATCGCTGCTGAGGTCTTCTATCGAAGTAACTACT
GTAACAGACGATACCCCGTAGTATGGCGACTTCCGATTTCGATGCCATCGTCAGACTCCAGATCAGACGTGGACACCAAGCGAAAGTGTTACGGTCCAAC
TGAAGTAGAAGGGCGTGGCCCGAATTACGAGTGAATGGTCCCAGACAACTTCCGCGAAGAGTATGGCGCCCTGCGGCTCTTCATCAcccacgaagaagat
gcgATTCATAATTATCACGTGGCTTAAAATCAAGAGTGCACCAACGGGGGCAGCAATCCTTACACGAAATCGCAGCTTGTCTCTCACGATTGGAGTAAGA
GCATCGAGCCTGAGGGCCCACAAGAACCATAT