Description :
From Genome Similarity Track
Location :
Scaffold_154:84629- 86984
Sequence
2355 bases(100 bases per row)
gacttagattaggtaaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCCGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAACGCTTGT
TTGAGCTCCTCTTTGAACActtcgtacgtgctgaagcacgtaggatcggagagtcggcgttcatacgcccaactccttgcgcgtccgccaaggcagatat
ggcgaacgcgaccttcgacagcgggtcgacgatgcgtccagccgctatggttgtgtcgagttcgacaagccaccggaggagaggctcgccctctcttccc
acgcaattgcttacgctcaactttaatggttgagcacgcggtgtcgtccctgacgacgccgtcactgaggaagcagcatcacgctgctccttcatgatga
accccagaccaacaccatgttgctctgtcggcgatagcgtacgcagcatcgtggctatcgccgcttctccaatgactgttgacaggcgttggagggcctc
ccactctgggtcagacaggtgggggcagtcagcgcgtgcaacatgcgttgcaggcgtgttggagctctccatgggcacctccgtgctcatgtggttctcg
gctccgcgttcgtacgccgcgtacgaacgtcaagcagtcggtcgttggacggactacaaagtgctaccaggtgtagtgggtctaacttgactcactactt
tagcttacacgttgcgcaacgtgtaggaggaagcgtaagtacttagtaattacttaggttaattatatttgaatacacaaacataattgaaatcagataa
gattccaactagctagtttaaggtaaaatgagaactgtattgtttgtaaattgaccttcctcctaaatctgctaaaaactgtttatcatctatgaaaggg
gttgacagcggccggctgtcagagccccgctattatgcatgtctctgattggtagagagatgctgctttttaccaataggatctttgggtatgtgtggac
cactcattgtggtggcccacttcaatgtatccattggtgtgtcttacaccaatgt