Description :
From Genome Similarity Track
Location :
Scaffold_221:84602- 88973
Transcript NameFunction/comments
Phyci_251394putative elicitin protein RAM3D
Phyci_98395Hypothetical protein
Phyci_98396Hypothetical protein
Phyci_251388sporangia induced conserved hypothetical protein

Sequence
4371 bases(100 bases per row)
CACACACGAACAAGTGGCGTCCGCTAACTTATTCTCCAATTTGCACAACTCCACCAACGCGGACCACTCCTCTGCAAGTCACCAACCCATCACTATGAAC
GTTCTGACCATGATCGCCGCTGCCGCCATTGCTTTTGTGGGCTCGACTGGCGCCTCCGGTTCGTCCAGTGGCAACGCCTGCTCCACCTCGCAGCAGTCGT
CCGCATACGTCACGCTCGCCAGCCTGTTGTCGCTGAGCTCGTTCTCGGGATGCGCGACGGACTCGGGCTACAGCCTCATGTACTCCACCTCGCTGCCCTC
GAGCGCCGAGTACGCGAAGATGTGTGCGTCGAGCAACTGCACGTCGCTGATCAAGTCGATCGTGTCGCTGAACCCGCCCGATTGCACCATGACGGTACCC
ACGAGCGGCCTGAAGGTGAACGTATACGAGCTGGCGAACGGCTTCTCGACCAAGTGCTCGTCGCTATCGACCAACTCGTCGACCAACTCGTCGACCAACT
CAACTAGCTCATCGACCAGCACCACGAACTCGACAGTAACCGCGGTTCCGACTACGACGACTGCTACCCCAGCGACGACGGCTCCTTCATCCAAGTCGAC
GAAATCCCCCGCCGCTACGATCGCTCCTTCATCCAAGTCGACGAAATCCCCCGCCGCTACGACCGCTCCTTCATCCAAGTCGACGAAATCCCCCGCCGCT
ACGACCGCTGCACCGAAGGCGTCGTCAGCTCCGTCGGACAGCTTGCCCTTGTCCACCACCGCTGCCGCGCTCATGCTCGTAAGTTTGCTCGCATCAATCT
AAACGACGCACAGCTCGTAGCCTAACATACCACACTGCTTCGATCGCATGCATCCACAATCTATCCGGTAGCACCAAATGAAGTTGCAATTCTGTTGCCC
ACCAATGTGTCACCCAATCGTGAATATTCGGGTTGAAGTTGGCGTAACCGGGTTACACTCGAGTAACCTAGATACCCGATGGACGTGCAGGAGGTGAGCG
ACGAGGAGCTGCTGGGCGCGTGGAAGCCGCGCATGGGCGCGCTGTCCGTGGGCGAGAAGCTGGCGCAGGCGGAGCTGCTGAAGCGCCAGGGCAACCTGCG
GGTCCAGCGCGGGGACCTGAAGCGCGCGCTCGCGTCGTACGCCAAGGTGTTCGCGTACGTGAACGGCCTGTCGGTGGCGGGCGACGCCATGGCGCAGTAC
GCGCAGGGCGCGGCGGGCATGACGGCCACGCAGGCGCAGGGCGCGCAGATCCAGGCCGTGAAGGTGGCCGCCTGGGCCAACATGGCGCTGTGCCACCTCA
AGCTCGGCGCGCAGCCCGAGCGCGCGCTGGCCTGCTGCGACCAGGTGCTGGCGCTGGAGCCGCGGCACGGCAAGGCGCGCTTCCGCAAGGCGCAGGCCAT
GGCGCAGCTGGCCCACTACGAGCGCGCGCACGCGCTGCTGGCCGAGCTGCTGGAGGAGGAGCCCAAGAACGCGGCCGTGCGCGCCGAGATGCGCGCGCTG
CAGGCCAAGAAGCGCGCGTACGACGCCGAGGCCCGCGCCAAGGAGAAGAGCGCGTTCGGCAACATGTTCAAGTAGAGAGAGGAGGGGACGAGCTGCTGCG
TCGAAATGGCAGGGGGTTCTGTGGGGTCAGATGCACTCGTTGTTGGTtgttgttgctgctgctgctgctgctgTGTGTCTAGGACCGGAAGAGGTGCGGC
AGCACGCGAGACTTGATGGCCTCCATGACCTGGCCGTAGCTGTGGCCGAAGTGGTTCTCCACGCGCGGGATCACGAGGTCCGACACCTCCACGTTCACGC
AGGAGGCCGCGGCCGCGAAGGCGACGGCGTGGCAGCCGGCGGCCTCCGGGCCGTTCGGGCCCGGGAGCTGCAGCGCCCAGAAGAGCTTGGACAGCACGCC
GTCGCGCACCGAGAAGACGTTGACGAACCTGCCTCCGTCCGGGTCCAGGGCGCTGGCGACGTTGGCCAGGCCCTGCGCGTCGGGGAGGAAGGCGCCCGCG
AAGCTCACGGCGTTGGCGACGAGCGGCAGGCCGTCGCCCCTCTTGTCCGCGCGCAGCTTGGCCAGCTCCTGGAAGGTGCTGTAGATGACGGCGCCGCCCA
GCGAGTGGCCGAGCAGCGAGATCTGGCGCCCGCGCAGCAGCGCCGGCCGCTCGGCCAGCACCTGCGCGAGCAGCACGCCCACCTGCTCGGCCTTGCCCTG
CGCGCTGTGCCACGGGTTGCCCGTGAAGTGCGCGACCATGGCCGACACGGACGCGCTGCCGAGGTGGTCGTTCACGTGCGCGACCATGGCCGACACGGAC
GCGCTGCCGAGGTGGTCGTTCACGTGCGTGCAGAAGTCGTTCCAGGCGGCCGCGTCGCCGGCCTCCCACTGCACGGCGAACACGGCGGCGCGTTCGTCGC
CCTGCGTCCACGCGCGCCAGTTGTGCGTCGGGTCGTCGCTCTGCGTCATGAAGCCGTTGATGCAGAGCACCACGTGGCTGCAGGCGGCCACGTCGCCGCT
CAGCAGCTTGAGCTGCAGCTGCTGCACGCGGCGCTTGCGCTTGGCCACGTTGAGGGTGGCCACGGCGCCGTCGTACGCGCTGGCCCAGAGCGTCGGCGTc
ggcgcctgggcggtggccgcggccgtcggggccggggccggccgcAGCCAGGCGTTGAGCGCGCCCAGCGCGCCGCCCACGGCCGCGGTGGCCAGCTCCG
AGCCGCCCAGCGCCTCCTGCTCCTGCTGGTTGCACTGCAGCCGCACGCGCTCCACGACGGCCTCCGCCTCCTGCACGAGCAGCGCCGACACGCGCGCGCG
CAGGGCGCCTTCGTCTCCGCTCGCGGCCGACTCGAGCTCCTGCAGCTGCTGCGCGGACAGCAGGCCGCGGCGCCGCAGCTCGCGGCAGTCGGCCAGCAGG
TCCGGCGCCATGATGATGTGGAGATCTGCAGATGTTCTGTACACGCGCTGGTGTGCGCGAGGTGTAGCGCTGCACGTTGAAGTGGTTACGCCTCTTCGAC
GGCCTGGAGCGGGCACTTCCAGACTTGGCCATGGCCGCCACGACGCCGGCCATCGAGCGCCTGCCCGACCACGTCCTCTCGGCGCACGTGTGCGGCTTCG
TGCACCTGCAGGACCGCTGGCACGGACTCGCGCGGGTCTCCAAGCGCTGGCGCCGCCTCGCGCTCGCGTCCGTGCGCCGCGAGCAGCACGTCGACCTGGT
GCGTTGCGGCCGGCCGCGACGGTAGCTGCTAGCGATCGGCCTGACTCACGTGGCTCTTGTCGTGTCTGCAGACGTGGTGCACCGGCGAGCACGAGCTGGA
GGCGGCCGCCGCCGTGCTGCTGGACCGCCGGCCGCGGCGCAGCAGCAGCGGCCGCAACCTGTCCGTGGACACGTCGCCGCTGCAGAGCGTGGCGCTCTAC
GGCCCGCGCGTCACGTCGCCGCTGCTGTCGCACCTGGTCGAGGGCCTCGACTCCGAGCAACTGCGGCACGTGGACGTCGAGTCCAAGCAGATCTCCGACA
CGGCGCTGGAGCAGCTCTGCCGCTGCGTGAGTCTGCAGACGCTGGCGCTGCACTGCATCAAGCTCACGGACGAGGCGCTGGTGGCCATCTCGCGCGCCTG
CCCCAAGCTCACTAAGGTCGATCTGTCGGGCTGCTCGCGCGTGGGGGACGACGGCGTCTTGGCCATCGCGGCCAACTGCCCCAGGCTCGAGACGGTCGAC
CTCACCATGTGCCGCCGCATCACTGACAGGTCCGTCGTGGCGTTGGCGCAGCATGCGTCGCTCACGCTTGAGGAGGTTGTGCTCGACCGCTGCCTAAAGG
TACGTGTTGAAGTTGAATTGCGCTCGATCCCGGGCACTTGACTGATCTCCTCTCTCCTCCAGGTGTCTGGCCCAGCCATTCGCTTCCTCGTGAGATTGCA
GCGGAACCTCCGGTCGCTGTCGTTCGCGCGCTGTCCGAAGGTGCAAGGCGTCGACTTCTACAACTTCACGCAGATCGTCCAGACGAAAGCGGTCATGCGC
GTCTGCGATCTCACAGCGCTGGACTTGAGTGGGTGTGCAGGTTTGGATGATCGTGGTGTGGCGGAGCTAGTCGCTGTCAACCGGCACACCTTGCGCTCGC
TGAACCTTGGAGCGCTGCAAACTCTGGGCCGCGCCACGTTTGCAGCCATCGCCAAGTGCGCAGAACTCGAGTCCCTCAATCTGTCGCTTTGCAGGACTTT
GCAGAACGACGACCTCGTGGCTATCACGTCGGGGTGCGCACAGCTTTCGACCTTGTTACTGCAGGGCTGCGTGGCTCTCGACGACGTCGGCCTCGAGGCG
ATGGCACCGAGAGCTACAAATCTGCAGCGACTGTCGCTTGAGTTCTGCTATAACATCACCGACGAGGGATT