Description :
From Genome Similarity Track
Location :
contig_68:8460- 10502
Transcript NameFunction/comments
g11345.t1hypothetical protein

Sequence
2042 bases(100 bases per row)
ATGGATCGCAGTGACTCCCAGGAATCCTCTTCGTCTTGGAGGCCGACCCAAGATACAAACAGCTGCCAGTCACCATGTTCGTTGCGATGCTGTTTGATAG
CTTCCACTCCAAGAAGCATACCCTGGTTGCCGATGTGAGCGAGCATCTCATCGTTCACGTTGAGCATGCTGTCGCTGTAAAACTTCAAACGCGAGCCATG
GACATCGAATGTCTGGTCTGTCACCAAGTGTCGGATGACAAACGAGTGCGGGCGGGTTTCCACTACCTCAAAGGGTCCGACCCATTTTGGCGAGCAGCTT
GTCCACTGTTAGCCTCTGGTCGATCCTCGACCAGAGCACGAAATCACCAACTGCTAAGTTGCACGGCGATCCCTTCGATTGTTGCATGTTCTGAAGTCGG
CGTTTTTCACGGAGGTCAACAACCTCCCGGTGCATTGCCGCGAGATCGGAACGAAGACGTTCCATACGATCACCAGGTAGCGCGATGTCCTCCGTAAGCA
CCACCTGTTTGCCATTCATCTCAATGATGACAGGCTCGAAAGGAGATGGTCGTCGTAGACCAGTAAACGTCTCCACAGGCGACCGATTGCCACTGGTGTG
TGGTTCAGATTACCTTGCACCAACGGGAGCAGGTACACCCACTCATGGGTGTCCAGCTTGAGCTCCATCAAGAGAACCCTCATCACCTGTAGAATGTCAC
GGTTGACTCGTTCAACCGTGCCATTAATCCAGGGCGAGTAGGCCACCACAATCTCTTGTCGTAGTTGCAGCTTCTTGTACACTTGCTGTACGACAGCGTT
TTTTAAGTGGCTTCCTTGGTCCGAGATCAGGACCGAAAGAGCTCTGAATCTCTTCCACCAGTCCACTAGAGCTGTTGCTGCCGCGATGCTCGAGGCAGTA
TCACACGCTATCAACTCGCAGTAGTGCGAGAGTCCATCCTTCAACACCAGAACGTACTTGCTAGCACCTGCGCTTTCACCCATGAACAGGAAATCCCAGT
GCAATAGTTCGTTCGGCCCCGTAGCGTCGTAAGTTGGGCCCCACGGCCGAGTGATGATGTTGCCGCCTTTCACATGTTTGCAAAGCAAGCAACGGCTGAG
GAAACGGCGACACAGTGCGGACAGCCCACTGATAGAAAATACCGACTCAATTGTCGATACCATGGGCTCCAAACCACGGTGGCCTTGCAAGCCGCAATGG
CTTATCACTAAAATTCGTTGCAGTAATTCCGTTGCTGCGGCGGGAACCCAAAGGCGATCATTCACCAGCACGAGGCCATTGTCATCGCGTCCCACCTCCA
ACGGTGCGCTGCTTGCATGTTCTTCTTGTGCAGCACGAATAGACCCCAACGACGAAAACTCGAAGTCGTCAGATATCATGTGCAGCCGCTGTACTTGATC
TACAGGTTCGGCGTGGTTCGGGTCCACTAGCACCTCCGAGTGCTCTGGGAGCTCATGTCCACGATGAACTTCATCCACACGGTGAGTGTGATCCTGGTCC
ACTCGCACCTCTGGTTCCACAAACAGATTCAGACTCCTCCGCGTCATCAGCTTCTGCGAGCTCGCGAGCGCGGCTTCGTGTTATGAACTTGCATTGCATA
CCGACCCCCGCTTCCTCAACCGGAAGCCCCCACCGAGAAAGCAAATCTGCCCACAGATTATCGGTGTTCAACCTGAAACGCAAGACCAGTGAGAGAAAGC
GTCCAGCGCTGTAGCTTGCCGCGAACATGGCGTTTCACTTCCTTGTCTGGAGCGAAAACGAACACGAGGTTCTTATGATCGCAATAGAGACGGAATCCAC
CTCGACGAACAAGCAGGTATCCCAGGTTACGCGCAGCGAAAATGATCGGGAATGCCTCCTTCTCAATGATACTCCAGCGCTGCTCTGTGTCGCTAAAGAC
ACCGTTCTTACACAGCAGAAGCTCATGCTGCTGCTCCACAACAGGCAATACATCATTCCACTCACGGACCTGTGAGACCAGTAGCCCCCAACCACGTTCA
GACGCATCGCTGAAAACACACAGGCTGGCAGAGTCGACAGGG