Description :
From Genome Similarity Track
Location :
Scaffold_1479:846- 7634
Transcript NameFunction/comments
Phypl_g13516hypothetical protein
Phypl_g13517reverse transcriptase

Sequence
6788 bases(100 bases per row)
ATGGCGGTTGCTGACCAGGATCGGGCCCTACAAGATCTCCACCAGGCGCGCGACGACATCACAGCTTACGAGACTTCACAGAAGGCTCTGGAAAATGCTA
CCGGGCGCCTTCAACACCAGATCTCCATTCTGGAACGTCGAGTCAGCGATCTGCAGTCAGGCCATGATTCGGATGTCACGCGTCACCAACGACAGCTCGA
ACGGGCATTCGGCGAGCGCGATCGCTTCCAGTTTCGAGTTCGGGACGTCGAGGCTCAGTTGCGTCAGGTGTCTGCCGACCTCCGCCGCGTCACTGCGGAG
CGCGACGGAGCAACAACCGCTCTCCAGAATAACCGTAAGTTCTCCTTAACTTCTTCACTCTCCATTCACGTACTCACGGCTCCTGCTTCTCTTTTCACAG
AATCCCAGATCGTCGCATTCCGCACGGCAACTGCGCGCCTCGAACAGCGTGTGAGTGACCTCCAGCCCGTGCAAGATAGACTCCGTATACTCGAACACGA
GAAGGCCCGACTAATCGCGGATCTGGCGGCCGCCCGAGCTTCCGTGCGTGATATGGCTGCGGAACGTGACCAGGCGCATGGCGAGCGAGACGCCATCCGA
GACCGTGTCGCTGGTTTGGTTTCCTTCCTCCAGCCTGTCTCTGCCGCTGGTCCTCcgctgcgtgctgcttctggcaAGCGTCGCCGAAGCCAATCTCCGT
CGGCATCTCCTGACCCTTCGCGTTcgcatggccgacgccgaaCTTCGAGCTCGGCACGGTCACCTGGATCGGGTCGACTCGGGAGTCTGCGTGACAGCTG
TCAAGGCGATCGAGGTAAAGGCCATGGCGGTGACCGCTCTGACAATCAAGATGGCGACCAGAGTGACGATCAAGACGGGGATTCAGACGGCGATCAAGAC
AGCGATTCAGATGACGATCAAGACAGCGAGCTTGACGAAGATCAAAACGGTGATCCTGACAACCATCGCGACGGCGATCCTGACAACCATCGCGACGGCG
ATCCTGACAGCGATCGAGGCGGCGATTCACACGACTCCGATGAGAGCAGTGCTCATAGTGACGACAGCATCACCAGTGTGCCTCGCGTTCACCGGAACCG
AATGATGTCAGACGCCCGATACCGGCATCTTCCCCCGGCCCTCGTACCTCGCCCAGATTGGATCCCTGGCTACCGGCATAGGCTCGAGTTCCCGCAAGCC
GCCATAACTCCATGGCGTCCCCGTCGAATTCGCAAGGTCTCCGTATTGGAGATGAAAATCTCCGTTTTGTTCCATCACTTTGCCCAGCCCAAGAACTGGC
TCTTTCCTCTGAAGGAGTCAGGtgcttcgccttctccgtcgctcTGGTCCCCCCATTCGCTCACCGAGACCAACATCAGGGCACTATATGCAACCAGCCC
GTGGATCGTGCTTTGTACGGTGGTGACGCCGATCTCGTTTCCCATGAGTGGTTGGTTCGAGGCCTTGGTGCGACGATATATCCGGCTTGAAGACGAGCAC
CGGCAGGCGTTATGGGAAGCTGCTCACGGACTCCCGATCAGCTCCGCTCTACGCAAAAATACCCATTCCTGAAAACGTTCTGTGCGGAACGCAAGCAACG
GCGATGTCGCTTGGGGGCACGTTGGAAGACGTTTCTCAAGGCGGTCCTGAAAGGAATGATCTTAGGCCACTGCGATCTGGACATACTCCTCGATCCGTTC
TTCCGGCAGTACCCCCGGCACAACGAGAAGCGTTTGTGGTATCCGGGTCTTGGACGCCATCCCCAACCTGTCAACCTAGTGGAGGCTCTCCACGCTGTCG
ACTTGGCGGAGTCGTGGCGCAACCAGTATCGCGCCAACATTCAAGATCACCCCGGCTCCCAGATCGCTCGTTTGGTCGACAAATTCACTTCCGTCGACGC
CAATAGTGACGAAGAATTGGCGATCCGCCTCGTGCCATTAATAcaacttcttcgtcttcttgatCGGGATAGTTCGTAGCGTTCCCTCACTCACTCATTT
AAAATAAATTCCCTTCCACCTTAGCGCGCAGCCATCCGGCACGCTCTTCACTCTACTCCTCCCCGCGGCAGCCAACCTGCTACGAGTCTTGCGTCGCTTC
CTCATGCGACTGCATCACTCCAAATCGATTGCGAGTGGTCATTTCACGATCGTATTCACGCACCGCAGTTAAGATCGGCTTCGTCGACCCACGACGGGTC
ATCGTAGCCTCTCCAGTATACTTTAAACTCGCGGTGGACGCGCCCGTAGCGCGTACGTCGACCTTTCCGCATGTCCTCAATCCGTTCAACCTCATACTCG
CCATCGCTGAGCCTGCGCTCCCAGCTGTCCTCCGGCAAGACAGCTTCACAGAAGTCAAAGCGATCCGTCTCCTCTCCCACCAGCTCGATCTGGGGCCGAT
CGGGAAACACCCGCACCAGCTTTAGCTTCGAGACATGCACAATGGGGAATAGTCGATACTCTGTCCCACCTGTCTCCAGATGTGCAGCGTGACGATCCAC
CATCTCGATCACCCGAAACGGCCCATGCCACATATGAGCTAGCTTGCGCGCATAGCCCTCCTTCACACGATCGAGATATAGCCACACCCGTTCGCCCTTT
TCAATCATGTGGGGTCGGACAACTTCGTTATGCCAATCTGCGCGACCCCGAATCGCTTCACGTAGGCGCTCATTGACTTGCTCCCTCGCTCGTTGATAGT
GCTGTTGCACATGATACCGCCATCGACGCGGCTCACTGTCTCGGCGCCGCGTACAGCCCAGCGGTAGAGATGCCTCCAGCGTTGATCGAGCGTCCCAACC
GTGGACCAAATAAAATGGGGTGTCTCCGCGGACGCAATAATGGGTCGTGTTGATCGCAAACGTTAGACGTTTTGCGTACTCGTCCCAGTCTTGCTGATTC
ACGTCTGCGACGTACATCTTGAGTGCGCGAGTTAACGTCTGCATCATCCGTTCAGCCGTTCCGTTAGCTTGTGGGCGGTACGCCATCGTGGCCTTCTGTT
TCTGTCCGACTATCCGGCTGAACGCACGGAAGAAAGCAGACATAAATCCGGGTTCTCGATCGTGTCGGATGGCTTCACTGGCTCCGAAGCGTCGAAACAC
GCACTCCTCGTAATTCTCCGCGATAGTCTGCGCTGTGCGCGACGCACTCGCCTTCGCGATCACATAGCCCGAAAACAAGTCGACCCAGATCAACAGCTCG
GTGTTCCCTTTGAACGACTTATGCAGCGAAGGGATGTGGTCCATCGCCACGATCTGGAACGGGTAAGTGGCTTGCACGTTCCCAGGGGACTCTCCTTGAA
CAAAGGGGCGCCCCTTCCCAGGCTCACAATCTGTACACTCTCCCACGTAACGCTGTACACTTCGATACAGGCCTCGCCAGTGAAAGTGCGATCGGATGCG
AAGGTACGTCCGCCCGACTCCTTGATGGCCTCCCTCCAGACTGGCATGATAGTGATGCAGGAAGTCCTGTTGCAGTGTCTCCGGTACTACGAGTCGAGTG
ACTGCATCGCGATCCCCGTCCTTCGACTTCACGGCGgggcagaagaagagcaggccactctcgtccagctcgtagTCAACTGCGATCTTGGAACAAGACT
TGGCTTCCTCGGCggtcagctcctgcacgtcgcccttcAAGTAAGCCTTCAGATCAGCGACCCACTTCTCTTCACCCTGCGCTTGTCGTATCCGCTCACC
TCTCATGCGTTGCACGATCGCTTCTTGTAGGACTTCAGGCTGTTGGGGTCGTCGTCTCGCCGATCTCGCGACGGCGCTTGCGCGGACGACCGTGTCGATC
GCTTTCGGCTTCAGCAACTCATCCAGTCGGTTGAGAGTGATCAAGTCTTGGCGATCCTCCTCCAAGGTAATGactgcgccttcttggctTTGTAACGCGG
CACTCGCTAACCGATCGGCGCTTTGATTCCAGTCGCGCCTCGACCATGATCTCAACTtttccagcgccttctgtcgtaacagcagcaacccggGCGCTTT
GTAGTCGATCTCGTCACGCATCTGCCTGATCACCAAGTTGGAATCTCCGCAGATGACCAGTCGCCCCCTGTCCAGATCGGACAGGAGATCGAAACACAGC
AGCAATCCTCGATATTCGGCTTCATTAACAGTCAGGTCAGCCGCATGTTCTGACGCCGCTGCGAGGATCGTCCAGTCGGGAAGCTTCCATACGATCGCGC
TGTAGGCTCCGGCCTTTCGCTTGACGCTCGCAGATCCATCGAAGCTGACGACCAGCAGATTCTCATTCAGCTCGaccgtcggcggcagcgtaGTGATCAT
CTGGCGTGGCTGTTTCTTCGGCGCGATTGCGACCAACGTCTCATCGACTTCAGATCGAGGCGTGATGCTTGCTGTGATCGTGCCAAGGATTTCGTCTTCT
CCTTTCGCACACTTTCGGATCTCAAGCGTCCATTCGGAAAGCAACGCAGCCCAGCGACCGAGTCTGCCGTTCAGTCCAGAGGAGTTCACCAGCCATGCCA
GCGTCGAGTGACGAGTCAACATCTTGGTCGCTCGCGTCACCAGCAACATGTAGCAGACGTTCAAGACACGGAGGAGGGCCAACACTTCTTTGTCGACCAT
CCCGTGGTTGATCTCGCTCGCCTTCAAGGTACGGCTAGTGAAAGTCACCGGCCAGTACACGCCATCATGTTCCTGCATCAGCGCCACGGCGATCGCCCAT
TTGCTGGCGTATACCATCACGACTGGAGTCCGATCCGGGTCGAAGTGACGGAGAATCGGTGTAGGACCGATCTTTGCCTTCAGCAGAGTAAACGCGATCG
TGGATCTCACCCAGCCATCGCTCTCTTCAGGAGATGATCCGACGTCCCCGGTCTCTCTGTTCCCAGCCTCGCCATCTGCTCGTCTACGGAATTCATGGAA
ATTCACCTCTCGCAGCTCGTACAAGATCGCAGCGTAGATCGCAAAATCTTCGGTGAAGCGGCTGTAGTAGTTcaagctgcccaagaagGACTGCATCGAT
CGCAGCGTACGTGGGAACGGGAGATTGACCAGGGAATCGAGGTCCTTCGGATGGGCTTCCAGTCCACCCGCTGACACCTGATGACCCAGGTAACCGACCT
TCCGGCGTCCCCAGACACTCTTGACGACACTGATCGAGAGATTCCACTGTTCGCAAACCTCCAACAGACGTTCGACCTTCGTGCAGAGGGTGTCCCAAGA
CTCGGCCGTCACCaagatgtcgtcgatgtacGATCGTCGCCCCAGGACGGACGGCTTCTGATCGGTGTCGGGTTCGCCGTTCTCGAAGACGTCACTCGTC
TCCCACAAGTCTGGATCCGCGCTGATCTTCAAGTGTCCGAACAAAGCATTGTCGATGAGTCCTGAGGCGCGTTCTTCAGTCCGAATGGCATACGCAGCCA
CTCGAACAGCCCGAATGGAGTGATGAACGCTGAGATCAACCGTGCCCTCTCGGTCATGGAGACTACCCAGAACCCGCTCGCCATGTCAAGGGAGCAGTAC
CACAAGATCTTATCCAAGTCATCCAGGAGATTGTTGATCAACGGCATCGGATACACCGTCAAGCGCGTCAAGCCGTTGACGACTCTGTAATCAATGCAGA
GTCGTATATCAACaccgttcttcttgatgatgATCACGATCGGGGATGCCCATGGTGAGGTCGAGTGCCAGGCGATCCTAGCTGACAGCAGACCCTTGAT
CAGCGCAGCCAACTTCTCTCGGAATTATGGAGCAACCGGTCGCACACGCTGGGCTACTGGAGTGGCACCATCAACGTCGATGTCGCACACGGCACCGCGT
GCCGCAGGTGGCAGGGCATTCCCTTTTCCGATCAGCAAgtgccgccttcgccagATGATCCGTCGCAGCCGGTCGATCTCTTCCGGGGTATTCAGATCGG
AGTCGCCAACCTGAATGTCCTCGATCGTTACTTCTTCGGTCGAAGCTGCTACCTCGGGCAAGATGACCAAGTTCTGTTCGAGATCTTCTGCAAACAAGCC
TCCTCCCTCATGGTAGCAGACTTGTTCTGCCTTAGCTTCCTCCGAGATCGACTCCCGTGAAGGATCGACATCGGTCTTCGGCAGATCCTGACTTGGCTCG
GTCGACTCCTCCTTCCGGATCGAGGTAGGCTCCCGGGCGACTCGCTCTTCATCCGGCTCTTCACGCTTCAACTCGGCTTCCGGCGTGCCTTCCCGTGTTC
CTTCGCAGGGCGATGGTAAGGCGGTCGCTACGGCCACCACTGGTTTAGGGGCCCCATCCGATCGACTCAGAATTCGTGTCGGCGTCGGATATCGAGGCCG
ATCGACCAGCGGTTCCGCTGGATCCTCTTCGGGTCCTGGTTCCTCCTGTCGTTCAGTCATAGCCTCGAATGCAAGGTTCTGCCATTCAGCGTATCTGCGT
GATCCGACTGACACAAAACCTCGCATGCGAGGTACGGCGTCTGGGCCTAACCAAATTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTCACTCA
AGTTTGTGATCCGCAGATACCTAGTTCTGCCTAGGCCCCTGATAGGGGTCAGAACCCATCTTGGACCCCGTGCGATCCAGAGCTTCGCGCTAGCCGATCT
GCCGCATCGGGTCGGGACCTCCACGGACTCGGCGACTGGCACTTCGAGATCTTGGTCAAGCGTGACATGCTGGACCGCAGCGCCGTACAGCGGATGCCGT
CCTAGCAGCTGAATCCGCACCTCATCAGGGAGACAGAAAGTCCCATCTGCCAGATCGAGGCGGACTCCGGCTGGTACCATGAAGTCCA