Description :
From Genome Similarity Track
Location :
Scaffold_1435:846- 3277
Transcript NameFunction/comments
Phymu_g13277hypothetical protein PHYSODRAFT_504800
Phymu_g13278lysosomal alpha-mannosidase, putative

Sequence
2431 bases(100 bases per row)
GACATCACGAGCGGCCCACCATCTCCGACTGGTACACAACCTTGCGTCTCCGAAGACGgaggttgaagttgctggcaAGCGGAAGCGAGATaccgagatc
gagaagcagcgcgccgCCCCACTGTTCGCCAACAATCCGGCTCGGCTGAATctactgctggagacgcttcGAATTGTTAACCACAACTTGCCACTGAAAA
CTGGTGAATATGAAGAGTCAAAattgctggaggcgctggtggtCAAGAAAGAGATGCAAACCGTTGTCAATGCTAAGCGCGTTAACGAGTCCATCGTCCA
GCTGTATCAGTCGACGAAAATGGAGATGATGGAGTACCTTGCCGATAACCGGGAAGTTTACCCGAACTTCACGCTAGTTGCCGATTTTTGGACCTGCAAA
ACCACTAACGACAAATACCTGGGGCTGAGGGTGTACATGGTCAAAAAAGACTGGCAGTTCAACTCAGTCCTTCTCGGGACAAAACCGTTTAATCCAGCTT
ATAGTGAGCGGGAAGGTGGAATTCAAAAGCCATTTCGTGTGTGGCTGACAAGTACACTAGCTGACTTTGGTCTGAAGCCGCAACACTTCTACGGGGCGAC
CAGCGACGCGGGTGGTGACGTCAAATTTATGCTGCGTTCGGATCTTCAGCTACGCTGGGAGTGGTGTTTCGTCCACATGGCCCACGCCGCCACAAAAATG
TCGTGTGGCCTAGGAGGAAAAAGCAGCAAAGAGGCCAACCCTGAAATGGCGAATCTAATTACGAAGATGACCAATGTCATTACGAATGTAAAGCTGGTTA
CCACGGCAGGCGATCTGTTCGCTGAACTTTGTAAGGAGAAAACAAAAGGAGCCTCCAAGCGTCTTATCGGGCATTCTGCATCGCGATTCCTGAGCACGAC
GAAGGCGATGAGGCGGATTCTGGACAAGTGGGAGGCGGTTGTCGAGTGGTATAAGATACGGGCAGACCAAGCCATCCGTGAGCGCCGACCACCTCCTCCG
TTCCCACTTGAGAATTGTCATTCGGAGCTCGTCCAGGCATTATCGCTTCTTATGCCGGTTTCAGAGTTGAAGTTCAAGTGTCAGGCAGAGCGACCGGAGC
AGGTGATAGTGCTAATGTCGCTTTACATGATCCGCATTGGCAACCTTTGCCCCGGCCAACCCATCTTGCACTACCTGTCCACTGACGAGAACCCACAGTG
GATACCGGCAAGCTCCCTGACACCGCTAGCAGCGAAGACCCGTGACCTCCTAAGCCAAGCTTTGGATGATCGCTTTTTCTCTCGATATTACAAGAACTCT
GAGTTTGCTAAGTGTGACTTCGTTCTGGAAATGATGCTCAAACTTCACCTGATCTACAAACACACACAAGAATTTCTCAACCGTGCTGTAGTACTGTGTT
GCCGGCAACATGGATTAAAGGGAAAGGAAGCTGTCAGCAGATTGAACGCGGTCAACGACAAAATTCGCTCCAACCTACTCTCCCTATTGAAGATGGTCGC
AGGGCCATTAGATGGCGACGCAGGCTATTTGAGCGCGTCCGCACCTCAGTTGAGTCGACTGGAGGCACGGTTTTCCCCACGAACAAGACCAGTTGTGACG
GCTCGCGTTGACAAACGTGCCGAAGATGAATTGGATCGCTGGCTGGATGATACTTTGGATGTTGAGCGTAGCGCCAACATGGCTCCGAAAGAGACCGTGC
TCCAGTTCTGGAAGCGGCTTGAGTATACTGGACAGTACCGAATCATTCCAAAAGCCGTGCGAGTGCTCTTTTCGATTCCTGTTTCGTCCTGCCAAATTGA
GAGAGACTTCAGCGTCAGTGGGGAAATGGTGACAGCGCAACGAACTAGTTTGTCGGGTGACAGCATCGACATGTCCATATTTCTAAACAGGAATCCCGAG
TTCGTCAATCTACTGCAATGTGAAGAAATCCCTCGTGGTCAGCACCGCCTGCACAAGTCTTCAAACCTTCTGCTTGACATCGACCCGGATTTCTACATGG
ACGACTTTAATCCAGATATTCTTGCCGAGTTTGAATCGAGTACCAGCATTTCTAGGGGATTATTTggcaatgaagaagagaagtCAGCCTTGTGAATAAC
TAATACAATTTGGATTAAACATACACTGCTCTCGCTTCTTGCTTCTGCTCTCATCTTCGTGGTCAAGATGAACACCCGCCGAGATACTTGCACCTTcagt
cttcttcgcctcagGTGTCAAATCCGCAACACGAGcaatgagctgcttgagcttgtcgtgAAGGCGGTTCATGATCttccgaagctgcttcttgtggtAC
TTCATCTCAACGAAACCAACCGGCTCTAGCACGCAACTCCGCAAGCGGCGGGATGTACACGgacgcgagctgctcgtagttTTTGAGGCTGTTCACAATG
GCAGCACCGAActtcagcacctcgtcgAACA