Description :
From Genome Similarity Track
Location :
Scaffold_2581:846- 2777
Sequence
1931 bases(100 bases per row)
GGAAACATCTGGCCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAA
GTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAG
GACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCT
AGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCA
ACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAAAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCAC
CTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTGGGATCCATGTATCTGCTAATCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCC
AGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAACCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACC
GCCTTTGCGCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCATACGAATGGGAGAACGCGGA
TCAAGATCACACTGGCAGTTTGCTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGATCAAGACACCATCCTCGGGATGGATTTCATAGTACC
AGCCGAAGTGAGGTTGGATCTGGCGGATGGAACACTTTGTTTCTCTGACGAGATGCGGATCCAGCTCAGCGGACAGCGACCGTTGTACGGGGCGAAGATG
AGGAACATAAGGGCGGATAAGACAATCTAGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAACATGAGAAATTGTGGGTCA
CTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTATTGGACTG
TGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGT
TCTGCTGAGCTTTCCTCACCTTGTGTACCCGTCGGCAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTG
GCGAGACGTGGGGATGGGGTGGAGCACCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGG
GGCCTAGATCGTGGATCTGGCCGTAGGTTTGTCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCTTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATC
TTGAGAGTTGAGAACCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGA
TCTGGGCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATCTCCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCGGCTCTTGAGGG
CAGGAAGGCACTTGCGTGTTACCGTGCAAATAGAAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCACTCGTTAA
ATCCCTTACCAGGCTCGGCTGCTTGTCCCTT