Description :
From Genome Similarity Track
Location :
Scaffold_2466:846- 1950
Sequence
1104 bases(100 bases per row)
GTTTGGCGAAGCCTTAAAGGCAGACGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTA
AAGGACACCAAGAAGGCGCTGAGCGCAACAAGTGGATCGGCGATCATCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTG
TCTCGATTAACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCC
TTTGCCGAGAGAGCTGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGCCAGGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCACG
TTCTGTGTCAGAAAGCCGAACGGCAAGCGGCGCATTGTTCATGCTTTTAACAAGCAAAATGCGGCCACTATCCCGGCCCAAACGCCGATTCCTCGCAAGG
ATGTTCTGCAAAACAACATGGTAGGCTGTACATTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCT
GACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGAGATGCCCATGGGCTGTCGAACGCACCAGCGACGTTCAATCGTCTTGTGACGCGGT
TGTTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGA
CCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGTCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGC
TTCATTGAGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGTCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAG
GCTTAGCCAATTACTTGCACAAGTACAGCGCGAATTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGATGCACCATGGTGCTGGAACGT
CGAG