Description :
From Genome Similarity Track
Location :
Scaffold_649:8459- 12827
Sequence
4368 bases(100 bases per row)
TCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCG
TGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTC
ATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACT
ACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAG
CTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAGCCACGCCCGGCTCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCATCATCTCTGC
GAACGCTTGGAATACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGG
GCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGAAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATT
TCGGTAGTGGGATCACGAAGTCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACT
CGAGCTGCAGTCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCGCCACA
CCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAAC
CGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGTTAACACGAACCGGTCAGCATACTTCCAGGCATCTTGAGCTTCTTTGTA
ACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGT
ATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACG
TCTCTCGTCGTTCTTCATGCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGT
CATCACTGCCATATTACCATAATCGCACTCTGGTGAGCTGTAGTCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGATTCGCTGCCTGACAGTACA
TGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCCGGATCGTAGATCATTTCCTGGATGCGATTCAGCGATGCCAATTCCGACT
TGCGAGTTTCAGCTAAGATGACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATA
TTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATC
GCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTAACACCGTTTATCATTCCTGTATACTCTGCCTCATTCACCG
TGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCGGT
CTTCGCTGACCCGTCAAAAGACATGACAAATCCGCTGTAATTACGGGAAAGCTTGGCGTACAGCAACGCGGGGGTCCATTCGAATAGTCGGGGAACCCTT
GTGTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCAACATCCTTCTCCTTCACG
CGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACGGCGAACTGGACCGCGCGTCCGAAAAGAGACTTCGACTTGTGCACCCACTCTAACGTCGAGAATC
GTGTATAGGCATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCAT
CTCAGCATCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGCTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAG
AGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTTGTCTTCAAATTTTCGAAGGAACGACGTGCCACAGAAA
GGCCACCTTCAACGGCAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCC
AAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGATCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTA
TGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCG
CCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTT
CGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCC
TCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGA
GTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGGGCATGCGTAACCACTCAAAATGTCCTAGTGCGCAGACGAACGCCGA
CACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCAGCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAGC
AGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCA
TCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGTGCGCAGCAGCTCGTACTGCTTGCCGAGAAATCG
CAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCCCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTA
GCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTC