Description :
From Genome Similarity Track
Location :
Scaffold_5:84553- 85972
Transcript NameFunction/comments
Phyta_totarag382hypothetical protein PHYSODRAFT_247490

Sequence
1419 bases(100 bases per row)
AGGTATCCACTTTAGTTGCTTCGCCGCTTGAGGCGGGAGAAGAATTCCTTTCAGTTTCAATCGAAAAGCACGATATATAATTTAtcacaacttcaactgt
tGTAATAATCAAGCATTGCTCTATTTCTAATTCTACCTGAAACGCTAGTGTATAGAATGCCGCAGGTTTTCGGTACCGCACTCGCTTCATTGACATTTTC
AGAACCACTTCGAAAGTCGAACATAACAGCCGACATGCATCGTAGTGTCTTAcacagcttgctgctgctggcggcgttGGGTGCCGTAGCATCCGCGCAG
TCGTCCAGCGGATCGACGTCCGCCTCCATCTTCGCAAACTCAACCACGTCCGCCTCCAACTCGTccgcgtcttcctcttccaaGACTCAGTGCGAAATCT
GCCGCGACTCGGGCGACTGCTCCGCGGCCTACAACGGGGCCGCCGGCCAGTTCTGCAACTCGTGGCTAGACTCGTCCAACAACCGCcgcgcctgctgctg
ccccgcCAGTGACGTCTGCTCTTCTGACAACAACTATGAGTGCACGTGCCAGCGCAAGAGCGACAGGCCGAGCTACTGGATCTGGATCGGgctcggcgtc
ttcatcgccggCGCGTTGATCGGCGGCGGCATCTTTATGGCCATCCGTAAGCgccgcacgcagcagcgtggtGGCGACTACCCGGCTGGAACTGGCGTGG
CCTACGCCCAGCAGCCAGTGTACGCTCAAGGCGGCTATGCCCAGCAGGGCTACGCTCCAGGGGCCTACGCTCAACCCGTGTATGCTCAAGGAGGCTACGC
TCAGCCTACGTACGTCCAACCAGGCTACGGTAACGGAGGCTACGGGGACGACTACCGACGTGGTGGGCGTCGTGGAATGGGCACGGGTGGTGCCGTGGCC
ATgggcgctgcaggaggtCTGCTGGGTGGGCTCCTGATTGGAGATGCCCTCGGTGacatgggcggcggcggtggtggtggtgattTCGGTGGCGGCGAGT
TTGGAGGAGACTTCTAGATGAACATCAAAGTGGGTGAAAAAGTCTCTTGAGAATAAAACAACGCATAAGGTTCATATTCCCTTTTATCCTATGCATTGTC
TTGGCCTGCTCTATATCGCcaacttctccttcagccgCCCGAGTGCAGCCACGCTGAGATCAAGTGACTCTGCACCTGCTAACTTGGCCTCATTGTTTCA
AGTGAAGTTTATCATTCGGGCGTCCTCGTTGCACGAAAGCGCCGCACATCTTCCTCCTAAATCTGCAGATAACTACAGGAGACCATCAATTGAATCAttc
ttgaagttgcctttttgtgAGTGATGGTTAGGATATGGGTACATCTCCTAGTCTCAAGGTGCCCCTCGCTCACTCTCCAATCCGTCGCCTTCTACACAAG
TGACCAAAGCTTTTGTGCC