Description :
From Genome Similarity Track
Location :
Scaffold_357:8455- 9920
Sequence
1465 bases(100 bases per row)
CTCGCATCAACGTAGCGGACAATCATATATTGGTCAGGGTTAGTAGATGTGGAGCACCATACGGACCAGGCAACGTCAAGTGAGTTTGCAGGCCTCTTGA
TGAGAGTTTCTCCTAATACAGAATCGCTGTGGATGACTGAATGTGGTAATTAGGGTTTCTCACTTCACCTTGACGATAGAAGTGTCGAAGGATATGTCAT
TTCGAGCCCTAGTCAATTGTGGGGCGTCGAACAACTTGTACGACTCCAATCGCTATATCATCGCCGGCTCGAGTTCGTTGAGCATGAGATCCCTCCGTCG
AGGATGGATGCACGCCTTGAAGCAGGCGCATTCGTAACAGTGATTAAGCTTGTCGTGGGATTCGCTAAGCACTGAAAGAGGTACAATATGACGTTTACTT
CATCGTATTAGACATGGATGACAAGTTTGATATCGTCATGGATTTATGTTTTCCTTAAATGTTGCGTCCAATCGCTGCTGGGGTCTCGTGAGTTCTCGTG
CGATCCAGGCCAAATATCCCGAGATCAGACTTCGCGATATTTGCTAACATTTTAAATTCAATCTTTTTGCCTTAAGATACGTGTGCCTTCAGCCGTCGGG
AAGCCAAAAATATTGATGAAATAAGGGGATGCATGTCTTGAGCAGAAAAGGTTGAATTCAAGTCTGATTATTCGTCAAACAAACTAAGCTACCTATCATT
GTACATACCCTAAATTACAGAATACCATCCAGATCTATATCACTTTAAGCTAGACCACCCCCTTGAACACGTGCCGAAATTTTCGGTCTATATATCAATA
ATCACACGGATAGTCACAATAATGTGCTCTCGAATCGAAATATTACCATATCTCGAATAATGCTATTGTATCCAGAACATCTTGATTATATCCATACTGT
TAGAAATATATCCAAATATTGAGCCAAGTATGTGTGAATCAACGTTATAGCATCAATTCGGACACCTTCCACCGGTTCGTTTGATCTGAACTTTCGGAGA
TCGGCTTCCATTATCTTTACTACCTCTCCTTGCCAATTGTTTCCATCTAAAAACGCCATTAGATGTCCTTTTACGAATCTACATCCCGATATCATATCTA
TTTTTGCTATATAGGTGGGTGTGTGGTGGCACACTTTCGATCTGTCTTGAGTTGGTCCACACTGCCATATCACATGCTGTCTATAGTCAAATCACCTGGA
CTTAGTTATACTTTTGCGAATAAATTGGACCTAAATTCGTCCCTGAGAATCAACTTAAGATAGTGTCAGATTGGTTAATACCAGGCATATCACTGGTCTT
ACCAGTCGGTATAATATTCCGACTGTTGGGTGCCTCGTTGCATAAATAAACATCATCCTTGTCCCTATTCCATCAAATCATACACCCCACTTGCCATATA
GCGTGATATTGGTATAAAAGAGTACGGTAGCCCAAGATCCGCCCTACGTCTGTAGCGCATACCGG