Description :
From Genome Similarity Track
Location :
Scaffold_1:845495- 850073
Transcript NameFunction/comments
g256.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
4578 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTTGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTACGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCACGCCACTTGTT
TTTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCTA
AGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCTGCCTCGTGCGATTGCATCACTCCGAAGCGATTCTG
TCTAGTACGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTACCCCTTCCAGAAGACCTGG
AATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGC
TGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATTCTCGTCCGTTGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAG
CTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCG
TGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGT
CGTTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCT
GCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAACCATGGACAAGGTAAAACGGCGTCTCT
CCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAG
CGCGAGTAAGCGTTTGCACCATCCGTTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGC
GCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATG
GTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAAGAAGCTCCGTGTTGCCCTTGAACGACTTTGGCA
GAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGACGCCCCTTCCCTGTCTC
GCAATCCACGCATTCACCCACAAACCGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCAATTCCCTGG
TGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGCACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATC
GGGTGGTGTTCACACAGTAGAACAGCATGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCTGGTAGTCAAGGCTGC
TACGTCGCCCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCT
TGCATAGCTGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATATTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCA
GGCGGTTGATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTG
ATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAA
TCGATTTCACCACGCATCTGTCGGATGATCAGATTGGAATCTCCGCAGATCACAACTCGCCCCCTGTTCTGATCGGACAGTAGCTTGAAGCCTAGCAGAA
GTCCGCGATATTCGGCTTCGTTGACAGTCAGGTCGTCGGCGAATTCGGACGCGGCAGATGTGATCGACCACTCCGGGAGCTTCCAGACAATTGCACTATA
CGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGT
CTGGGCTCTTTCACTGGTGCAATCGCGATGAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTT
TCAAGCACTTCCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGT
CGAATACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCG
TAATTCAATTCGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGT
TGGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGC
TCTAGTCCACCGATCGTCGGACTCCGCTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCG
TAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCG
ATTCCAGATCTTTCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGAT
CGACAGGTTCCATCGCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGAT
CGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGACTTATCCGGAGGT
ATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAAGCGTAAC
GAACGCGGAGATCTTCCGTGCACGTTCCGTCATGGAGACCACCCAAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCC
AAGAGATCGTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCT
TGATGATGATCACGATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAA
TTGAGGGGCCACCCTCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCT
TTACCGATCAGCAAGTGTCGTCGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGA
TCGTGACTTCGTCGGTAGTGATCGGGGGATAGCCATCTGGCTTTCAACGTCTTCCGCAAACGTCTTCATTCTTCGTCT