Description :
From Genome Similarity Track
Location :
Scaffold_30:84511- 85572
Transcript NameFunction/comments
Aphin_H310_11337ATP-dependent RNA helicase eIF4A, putative

Sequence
1061 bases(100 bases per row)
ATTGAGTCGTTCGATGGCATGGACTTGCGCGAAGACTTGCTCCGCGGCATTTACGCATACGGTTTTGAAAAGCCGTCGGCGATCCAGCAACGCGCCGTGA
AGCCCATCTTGTTGGGCCATGATTGCATTGCCCAAGCCCAATCTGGTACCGGGAAGACTGCCACGTTTGCCATCTCGATCTTGCAAAAGATTGACCCTGC
TCTCCGTGCCACCCAAGCATTGATCCTTGCCCCTACTCGTGAATTGGCGCTCCAAATCGTCAAAGTCGTGATGGCGTTGGGCGACTACACTGGCACTCTC
GTCCACGCGTGCGTCGGTGGTACCGCTGTCCGCGACGACATTCGCACGTTGCAAACTGGTGTGCACATTGTGGTCGGTACCCCCGGCCGTGTCGGCGACA
TGATCAACCGCCGCGCGTTTAAAACGGACGATGTCAAGTTGTTTGTGCTGGATGAAGCCGATGAAATGTTGTCGCGTGGGTTCAAGGACCAAATCTACGA
CGTGTTTCGCTTCTTGCCCGAAAAGGTGCAAGTGGCCCTGTTTAGCGCGACAATGCCGTTGGACGTGCTCGAAGTGACGCAGCGCTTCATGCGCGACCCC
ATCCGCATCCTCGTCAAGCGCGATGAACTCACCCTCGAAGGTATCAAGCAATTTTACATTGCCATCGACCGCGAAGAGTGGAAGTTTGATACGTTGTGCG
ACCTCTACGAAACCCTCACGATCACACAAGCCATCATTTACTGCAACACTCGACGAAAAGTCGACTGGTTGACGGAGCGCATGCAGTCGAAGGATTTTAC
CGTGTCGGCCATGCACGGCGATATGGAGCAGCGCGAACGTGACATCATCATGCGCGAGTTTCGATCGGGGTCTTCGCGCGTGCTCATTACGACCGACTTG
TTGGCCCGCGGTATTGACGTGCAACAAGTGTCGCTCGTGATCAACTACGACTTGCCCACGAACCGCGAAAACTACATCCATCGCATCGGTCGTTCGGGTC
GTTTTGGTCGTAAGGGTGTCGCGATCAACTTTTTGACGGCCGCCGACTCCCGTTACCTCCG