Description :
From Genome Similarity Track
Location :
Scaffold_945:8450- 10052
Transcript NameFunction/comments
g11103.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae

Sequence
1602 bases(100 bases per row)
ACTGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCA
ATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGTAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCA
CGACCGCTTCTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGTAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACA
TGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAATTCCCCTCGACTACGGGAGTGAA
GTCGAGGAGGGGGAACTCGAAGGAGACAAGGACACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTACGTCGTCCACGCGAGGACGACCCGAACG
CTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGACGACTCCGCGGGATGGAGATGACTCTGCTCCATCCGC
TGTTGTTGCGGCCTCGCGCACTGGTTCAGTGCGCGAGCCGTGGATGCCGTCTCAATCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTG
TACGCGCTGTACTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGC
TCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCAAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGA
AAACTTCAACAAGAACCCCGCTGGCTATCGTGGCCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAATTCTCGAAGCGTGGTAAACTTGAACGACTGCAC
CATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGGCACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCACTGAGCGGGACGTCA
ACGGGTACACGACCATGTGTGTACCTGACGACCTCAAGACTCTGCGCGCCAGTTTTCAGGCGCAGACGTCTTCTAGTGCTGCGGATATTCGCAGCACTTA
TTCAAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCTATCAGGGCATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATTCGAAAATGAACCGGACCTCGGGTCTGGTTCCGATG
ACCAACAATTCACTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGAGGGGCGGCGGGAAGACGCCCCGGGTTTGGTCAGCCAAACC
TTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGC
GC