Description :
From Genome Similarity Track
Location :
Scaffold_721:8450- 9823
Sequence
1373 bases(100 bases per row)
GCCAGCTGGACATAACCGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGA
GGAACCGTACGGGGTGTAACTTGAGGTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCG
ATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCA
TCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCTCTTCTTGC
TCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTG
GCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAATCTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCA
CCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGT
TGACGAGTTGTAGTACAGGGTCGGTTTCTACCGGTGCTTGCGAAATTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTT
CAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGC
GCTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACAGCCCAG
AAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAAAAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGA
TAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGAC
GATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCC
TGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATTAGGATGTGCT