Description :
From Genome Similarity Track
Location :
Scaffold_221:8449- 14198
Transcript NameFunction/comments
Phyke_g6833type I inositol-3,4-bisphosphate 4-phosphatase, putative
Phyke_g6834hypothetical protein

Sequence
5749 bases(100 bases per row)
CGCCTGTGGGAGGAAAACCAAACCGTCGTCAACGTTCGAATTGAGAGCCACGGGAGGCGCTTCAGCTGGGGCGGAGGCCATGGGAGAAGACGCAGAGAGA
GATACGGCGACGGATTAGAGTCGCAGCAAGACCCATGGACGCGCGTGGAGGCGCGGAGACGGCAGGGGCGTGAGGGATGGCGGCTGTTTGCTAGTGGCGT
GGGCGGGGCTTGTTGATGTACGCGCGCTCGCTTCCGCGCTCCGTTAGACGACGGTATAGTATAACCAAGTAACTAGGAACTGCCAAAATCAGGGCTGGTC
TTGTAAATTTACAAAATACAAAGAACTGGCATATTTAAAGCAAAATACTTTTGTATCAACACAAGGTGTTGTAATCTCACAAAATCAGTCGCATGTATTG
CGTTGAgaaaaaggagctgcagatttCATGCTGCTTCAAGATCCTACAGATAAGGCTTTACTCTTGCCATCAGTAGCAGTAAGGACGTCGATTCCGGTGC
AATGAACGGGTGGCCCACAATCCCCCTGCACCTTGCACTCTGAgtcagcaacttcaacgacatGTGCATAGATGGATACATTTTCAACCTCTAAGCTCTG
GGCTTactcttgctcttctgcttcttcttcagaaGCGCCTTCTCTAGTGCACTCTGCGCACCGACAGCCTTTGGTTTATTGGCTGTAACAGGACGAGATG
GCGCATTTTCTCCACCTTCCGTTTCTTCATGAGCCTCTTGCATATGTTGCTGTGCTCTACCTTGCAACGGTGGAACCTGCTTTGTGAGCAGTAAATATGC
ACCAAATGGCTTTGTCTCCGTGGCACTCGGTGTGCTTTCTGGCTTGggcggtgcagcagctgctgctgctgctgctgctgctgctgctgctgctgctgct
tcatcctCCACAGTCATGGCAGGCTCCACCAAAACTTCAGCCTCTGCAAACTCCTCGTTGAATTCACcactactgctactactgtGCTGCACATCTATCG
AGGGTGCCTCCTTCTCACCGGCATGCTCTCCACGATGATCGACAGACACCATTGCTGGCGCTATCTTCACTGCTACTTTTTCCTCGTCTTCGGCATCAAG
TAACGAAGAGACAACTGAGGTTGGTGGGGGCGATGTGATGGTTATATTGTCCACCGCACCGTCGGGGGTTGCAGTCCCCTTGTTGTTCACGGCGCTAGAA
GTCCTCCCTCGAGGTGGCACAGTCTTCTTGTTCGCCAAGTTCTTGAGAGCCTGTCGCGCAGACGAAGGGTCCTTCGATAGTGAACTGCTAGATGTTGCAA
GTGACTCTGCAACCCGGGCGGTTGAATTGACATTCTCACCGTCCACTTCcgctccttcttgaccttgacGCTCTAATCGTAGCCGCTCCTTGTGGTTCTT
CTTTAGCGTAGACTCGAGAGCGAACTTTTTGGGCGAGAGTTTCCGATTCTGCCAAAACACATACGTGCCAGTAGGTTGTGCTGGCACATCGTTCGTTGCG
GTCGGCGCTGTCAAGTTGTCGGTTGGTGGCAGGCCGCCCCTAGCTTCGTCGATTGCTGTTGGCGGTCTTGTGTTTTTGCCTCGATGCAGTAGAGATGGCA
GCCGTCCACCCACTTTGCGCATTAATTTGTGAGCTAGCGATTCACGCCGGTCTCGTAACTCACGTAGCATATTTTGACGCTTCACCAGCAGTTCAGCGCG
TGGATCAGCGCTAGGGCCGAATCTGTCGGACGAGCTCACGAGTTTCTCAGAGTCGATTCTCTGTCGTGTATTTGAAGGTTGATCCGAGTTTATGGCTTGC
GATTGTAATGTTTGGTGATAATGACGCACGCAATGCATACCATACAGGAAGTGCTCAAAGTCCACGAGATCTGCATACGCTGGATCAAAggcttcaagca
gctcccTGACTGTCGGTGCTGGTACATGAACGCCCAACTCATATACTGCCTGCGCGATGGCTGTATGCGAGACTAAGCCGAGCTGTGCTGCATCCGCAGA
TACAAACAGCAATCGGAaggcttcaacttcttcgtcgctaAAATTGCTCAGCGTCTTACGAAGTGTCTCGCGCCTCTGAGCCTCTAATGTTCGGTGCAAC
TTCTGCTTGTGGGCGCGTAGTTGCCGCAGGTAGCGTGCGCGTGTTACCCGCGTGATCAATCGGTGCTGGATGCGCACGGCTGCTGCATATCGCAGACGAT
CATATAAGTTGAGTGACTTGGCCAGGTGTTCGTGCTCCAACGATCGCGCATTCTGTGGGTCAATACGCAGCGCAGTCCGGCCATACCGAATAAGTCTTGC
GATTAGCGTACGGGACCACCAATCCTTCACAGTTCGAGCCACAATGGACGCAAAGATGACGGTGGGTTCCACTACTAGCTCCTGCGTGGCCACGCCCACT
GCCCATGCCAACACGCAACGCCATGACGTCGCCAAACCTAGTTCCATCGCACTAATCGCCACAACGTACGCCATGACCACAAGCCAAAGCAGACATATTG
TGAACACTACATAGACTATCGATGCTGGATACGGAACATTTGTGGTGTCGTCGGCACCAACAGTGCTCACCCCGGCGGTGGTTTCTCCCTTTTGCCCCAT
GTCATGGTTTCCGTCCAGAATATCGCCGTCTGCAAGGTTTTCGTGGGCTGAAGGAGTACTGGCGATCAAAACCTGCTCGTGCTTCAGCGGTGCAGCTGCG
AGCTCACTTGCCACTGTGGGCGCCACGCTCTCTAAACTCGAGGCCAACAATTGTGAACGAAGCTTTCCACGAGTTGGTGCCGCAATTTTCAGCCCAACGA
CGGTCTCAAACGTCTCTCGGATATCTCTTTTTACCTCTTCCGCATCGGCTGTAGGGTCTGGTACACGTAGCTTGAGCTTGGAGTCCTTAGAAATGGCTAA
TTCCCGTGCCAAAAAGAACGCGCTGACGGCCATGAGAAAAAGAAGCCCTGCCATGGCAATTGCACAGTACGTAGCTACATCGGCACCTTGCTGGAATCGC
GTAAGCATTTTGGAACGACAGCCTGGCAATGCAGTAAACTCCGCCTGCGTCTTATCCACGACGATGCCGCTGACACTCAGCGCTTGGTACGTGATTTGTA
CAGGATCTCCATCCGGGCACGGGAGATATGGAGCGTCTGTTGGGCCTAAGAACCCACAGCAGCGAAGTTCTTGTTGCACTGTGTTCTTGAAGTAGCCTGT
GAGTTTTTCTTTCCACGCAGTCTCAAGTCGTTCAGCTACGCTAAAACCTGTTATGCGCACGCTCCAGTTGGTTAGTGCGCTGGCATCCTCTTGGACGACC
TCATGCATCATAAAGATCGTAAGCAGTACAGCCCCAAGTGCAAACAGAGCAGcaatagccaccaccaccaatgcCACAATTACAGGAGTAAGCTTCAGAC
GATGTGATCGTTTGAGCTGTTGCTCACGAAGATCGTTCGCCAGTGCTGCGATAAGAGCGACAATCACAAGCCCAAACGCAAGTCCAAGTAGCTCAGGAAC
ATCCTCGTCAAGCGGTACACCATAGAGCGAATTATTATAGCCAAGCCGAAGGAGACCGAGTAACGTAGCGAGCGCACAACCCCCAAAAAACAGTAGCACG
CCACACATCTGGAACGTTGCTGCCTCGAAGCGTGTGAGCCAAACAAACCAACGTTCCTCGGTCGTCGACTGCGTCGTATCAAGTGTGGAGGCTTCGTTAG
TCAAAACTGACTGGTCCATGATCTGGGGTGACCCCTGAATATCTCCTTGGCGATGACGTCGAAACCACGGTTTGCGGAAaagcagcaccttctcctttCG
CTGCCGCGCCGTAGCCACTTCCTTCGTTTCATCATCTGCCCGATTGCGTATGTGCTCGAAGAGCATGATTGTAGTGGTTTGCACGGCAAGTCCGACTATG
CCACCATATACCAACCCGAGGCCGAGTAATTCTCTTACTCCAGGCTGTTCACATGTCTTCAATGCCGTCCGGTAACACCCTTTTGTGGCAAAGTATCCCG
CATATACCGCAAGCGACGCAGCCCAAGCACAAAGCAAGCTCACAGTACGCTGTGCCCGGGTGAGTCGTGCGTCAAAATGTGAGCCAATCGAAGCCAGAAT
GTGATACCGTCGGAAATCGCGTCGGAAGCTGCCTGTCACATAGCGCAGTTTGCTCTCGAGAACAAACCAGGCCTCACCTTCGTATCGGCGGACATCCCGT
AAAACAAATGCACCGAGCACGAGTATCACTGCCTCCATGATGGCCAACGAAATGAAAAGCGCAAAAAGCCACGCAAAAGAAGACTCCACACCCTTTACTA
GAGGAGCCTTGCAGCCGTGGGAAATCACAAGCGAACACTGGGGATACCCAAGCGCTGGACGGTCGAACACAACGCCTTTGCCCACTATCAGCACTGGATC
ATTAAATCCACAGCATGAGAACTCTAGCCCTATTTCGTGTTGTGCGGCTGGTCTAAGATCACTCCATTGATCATCTAAGAAGCTCGTGAGTTGTGCAAGC
CAACTCGCTTCCGAAGCGGATGAATAGTGTGAAAGGTGTGCTGTGAGTCCTACACCTGCAAGCAGCGCAACCAAAAGAACCAACCGCGCCAAGCATTGCA
AAAAGAGTTGGTGCACACTGAACTGGAATGCTGCTCGTACTGAGTACGCATGAGTGAGTAAAGCTAACACCCCATACAGAATCAGTACCGCGCCCACCGA
ACGCGCAAACATCAATTGGAGTGCGCTGGAGCAAAACAGCGTCCAACCCGCAGCTACATCCAAGCCCAGGATCAGACATGCCAGTGCAGCCAGCGTTCCT
AACAGCACAATGAAAAGTAATGCAGAGCGCATGATCCGAAGGCGCCAACGGGGATGCCAGTTCTTCTGCCTTTGATCGAAATCAACCAGACCGCTAACAC
AGAGCAGTGTAATAACACTAAAGCCGGCCAGTCCTCCACATACTTGCCAAGCGATCCGAGACACTCGCGAGACGTAGCGTTTCATTGGGCTAGCACATCC
ATCGATGGCCTCTAAGGGACATCGTGCAGTGCTGTTCAAAACAGTCGCCTCGGCCTGAGTTTCCGTGAGAACACGCTTCTGAGACTCTGAGCCATTCCAT
GATTTATAGATGTCATATGTGGACGTCGAAATAAGCTGGCGCCACCCGAACTGTTCAGCTTGGAGTGTGTACGACACAGATCCATTCGCTGCGTCGATAC
GCTCGTAGCCACAACATTGAAGCGAATTCTGTACAAATTGTTTAGTAGTTGACGGCGCTGAGCTCCATACATCCTTGAGGCGCGTGTCGACTATTATCGC
GGTGATATGAGTGGGGTCGTCAAAGGCCAGAGGGGATAACTGTGTGGAAAACTTGTGAGCTACTCCCAACACGCTGAAAGCACCCACGAAGAGAGCTACG
CATGACCCTGCATAGCAAATTACTAGCCATTTCATCCTAGCTTTCATACATGGGCGTTGCAAAGTACTATGAGCACCCATCCACGCCACAATACCACCAA
ATCCTGCGAATAACTCCATCGCACCGCCAAAAGCAAGTAAATAAATACCAAGCCGTCGATCGAACACGCGCAGCAAATATGAAATCTGCAGGATGTTGAG
CTCTAAGAGCACATCAATCCCCAGACCGACAATACCCAggcctgctgctgctgcgcccAAATTCAATAGAACTAGTCCAACGACGCACGCTTGTTGGGAT
AATGAAGGTCGGCTATGCATTGCGTGGATTTCATGTTCAGATGTTGCGG