Description :
From Genome Similarity Track
Location :
Scaffold_30:84489- 85501
Transcript NameFunction/comments
Physo_134112predicted protein

Sequence
1012 bases(100 bases per row)
GTATTGACGTAGTCTGAGCGATACATGGTGACTGGAAGTTTACCACCCGGGTTCGCATCGCCAAAGAGAATATCCGTCATCGCCTGCGCCCCGAAAAAAC
CTGGGTAGAATGCTTCCACGAGGGCATCCGTCTGCCCGATGATATCCTCAGCCGTCAACACGCCTCCGTTCATCAGCACCACGACTGTGGGTTTGCCCAC
AGCTCGAACGCGTTGCAGCAGCTGCACCTGGATAGCTGGTAGGTCGATGTTGTTACGGTCTCGGACTTCGGCTTCGACGGATTTGTCGATACCAAGGAAG
AGAACAACAGCTTCAGCTCCTTGAACGGCCTTCACAGCCTCGACGAACCCAGCCGTAGAGTTACCAGTAACATTGCAACCCAGTGCATACGTCGTGCTTG
AATCTCCGTTCGAAGCACTCACAGCCTCAAACGGGGTCTTGATGCACCCCACTTCGTTGTAATCGCCATGACACATCTGGCCGAGATAGTTACCGAGCAA
GGCGCGTTTGGCCTGGGCGTGAGGCCCCACAACTGCCAACTTGACCCCTCTACGCAGCGGTAACACTGGCTGGTTGTTCTGGAGCAGGACGATGGACTTC
CGAGCGAGATCGAGGCTCAGCTTCTTGGCCGCGTCCGTGTTCACATCATTCGGCGTCACCTTCCAGTACGGTTGGTCCTCGATAGGGTCAAAGAGACCGA
GTTCAAAACGCAGCTTCAGCGTGTGGCGCAGAACGTCGTCCACTACCTTCACATCGAGCTGATTGCTCTCCACCAGCTCTTTCAGACACGCCATATATCC
AAATCCCCTACCGCTGTTGACATCAGTACCGGCGAGGATCGCCAGCCGTGCAGCCTCACAGCGTGTAGGAACGTAGTGGAGCCAGTCGGAGATAGCTTCG
ATAGCCCCCGAGTCACTCGTGATGTAGCCGTCAAAACCCAACATACCCCGCAGCAGCTTGTTCTCGAGTTCGTTGTTGGCGCATGCCGGAACACCGTTCA
CGCTGTTGTACG