Description :
From Genome Similarity Track
Location :
Scaffold_1:84473- 89459
Sequence
4986 bases(100 bases per row)
GCTGGCTGCCCTGCTGGTCACTCGTGTACCTCAGATCGACTGGATCCCTGGTTATCGCGATCACCGCCTCTTCCAGGGTCATGCGATCGCCCCCTGGACC
TCGCTAAACGTACACCAGACGTGTATCTCGGAGATGGACGTGGGCAGCTTGTTCAGCCAATTTTCCAAACCTGTGGAGTGGCTGTTCCCACTTCGCTGTC
CGACACCCCAGCTTCAGGAGTGGAGAGACAATCTGTTTGACGAGGATGGCGTGATTGCCATAATTAAGTCGGCTCCATTGTGACCAGGGCTAGTCCACTC
TGGTTTGATGAGGAGGGGTGGTTTGTGCATATAGCACATCTCAACTTGAACTACAAAGCAAAATACCGCAGGGTTACATACTCATGCCTTCCCGGTCAGC
ATCGCCAAGCGTCGCGCTAGTCGGTACCTGGGCGTCTTCTTCATCGGCCGTAAGCAGCGGTGATCCCGGGCAGGAGCCCGGAGAAATTCTTTCTCCGGCA
CATACGGCTCGGTATGATTCGTGGTCTTTGTGATCTTGATCTACTTTAAAATCCGTATTTACTCCATTTTCCTCGCAAAGGTGAGACAGGAGCTTGGTAT
CCAGCGATTTAAGATGGAACTACCCCGGGCAATCTTCTTGGCGCCTTGGCGGTCGCAGACGAGGCTGATCGCTGGCTTAATCACTACCGTACCGTGCCAG
TCGACCACCACGCACTTGGGATCGCACATCTGCCAGGAAAGTTCATGCCGGCCCTCCCACAGTCGCGTCATCTTTCCAGCGTCAACCCGTAGTCGTGCTA
GTAACCGCGCTGGTGGAGCAGGCCAAGTCCATCCAGCCAATATATGTCCCACTTTGTATCTCCAGATATCTAGAGAGTTTCTTTCGCTCACATCATTTTC
GTTTGGCCTAATCCAACTCCCTGTCGGACCTTCTCCGATTGGTTGCTTCTCGTTTATAGGCCCACAGCACGTTACGAATACCACCTCCTTCTCGAAGCTA
GCAACCACCCTGCAAGTCAATCGACCTCTCGCGTCTCCGCCATGGCCAGCCCACCGCAGATGTTCCACCGCCAACGCATCGTGAGACTGCATCGCCCCGA
AACGGTTTCGACCGGTCCGTCTACATTCGAAATCTCTCAGCAGTGCTCCGCAATTTAGGTCTGCTTCGTCGATCCGTGAGGGCTCCGCATATCCCGTCCA
GTATACCAGATATTCACGTAAGGCGCGGCCGTAGCGTGTCCGCCGTCCTGTTCTCACATCAGCGATCCGCTCGACTTCGAACTCGCCTTCGTCTAGATCG
CGCTCCCAGCTGTCCTCTGGTAGCAAGCCTCGTCGAAGTCTACGCGGGCGGTCTTATCGTCCGTCGGCGTGGTCCGGATACGTTTTGGCCAGATTCAGCT
TTGTCATATGTACGATCGGGAATAGTCGATATTCAGTGCCGGCAGTCTCTATTCTTGCCGCATGCCGATCGATCATTTCCGCGACTCTGAAGGGGCCGTG
CCACATGTGCGCTAACTTCCTAGCGTAACCTTCTTTGACACGATCTAGGTATAACCACACCTTGTCACCGAACTGGATGTCATGGGGCCGCACATTCTCG
ATGTGTCGATCTGCTCTCGCTGTAAAAGCTTCGCGCAGAGCTTCGTTGACCTGTTCTCGGGCCTCTTGGTACTCTCGCTGGGTGTTATAGCGCCATCGGA
GCGGCTCCTAGTCCTGGCGTCGTGTGCTGCCGAGTGGAAGTGTTGCTTCCAGGGTGGACCTTACGTCCTATCCGTGGATCAGGTAAAACGGCGTCGCTCC
GCGAATTCGGTCATATGCCGTGCTAATAGCGAAAGTCAAACGCTCCGGGTACTCGTCCCAGTTCTTCTGATCTACATCTGCGACATACATCTTCAACGAG
CTGGTCAGCGTCTGCACCATCCATTCCGCTGTGCCGTTGTCCTACGAAACGACTGAACGCGCCGAAAAAAATGAGACATGAAACCTGTCTCCCGATCGTA
CCGGATAACTTCGCTCGCGCCGAAGCGGCGGAAGACACATTCTTCGTAGCTCTCGGCTATCTTCTGCGCCGTTCTCGACGCACTTACCTTGGCTACCACG
TAATCTAAAAACAGGTCAACCCAGATGAGCAGCTCGGTATTGCCCTTGTGTGACTTCGGTAGAGACGGGATATGGTCCATCGCGACACATTGGAATGGGT
ACGTACAGTAGCTTGATGTTTCCCAGCGATTCTGCTCGAAGTGTCGGAAGTCCTGTTCCTGTCTCGCAATCCGCACACTGTCTCACATAGCGCTGCACAC
TCTTGAACAGGCCGCGCCAATGGAAGTGCGATCTCACCCGTTGGTACGTTCTTCCAATTCCTTGGTGACCGAATTCCAGGCTTTGAGGTAATGATGAAGC
ACGTCTTGTTGTAGATCTTCCGGCACTACCAGTTTCGCTACTTGGTCGCGGTTAACGTCGCCTCCCCGTGCGTTCGGGCAATAGAAGAGTAGGCCGTCCT
CGCCGGCTTGTACTCGTCGGCGATTTGGCTGCAAGTACGCGCCTCTTCAGCGCTTAGCTTCTCCAGATCACCCAACCGGTGCGTTTTTAGATCCGCGATC
CACTTCTCCTCGTTCTGTGCTTTCCGGATTCGATCTGTTCTCATACGTTATACCATACCCAACCGTATCACTTTCGGAGTACTCGCAAGGCGCGTCCGTA
GTCGTGTAGCAGCCGCTACGCATACGGCCTACGGGAGCAACAGTTTCGGCAGCCGGTTGAGATCGATCAGGTCTTCTGAGTTTATGTCCGAGGTAACTAC
GGTATCTGCTTGTTCGCGTAGCCCGTCGCTTGCTAGCCGATCTGCACTTTGGTTCCATTATAGCTTTACATGTAGGAATTCGTGTGACGGCCACGACCTC
AGTCGATCCAGCGCCCGCTGTCGCAGAGACGTCAAGCTGGGTGCCTTGCACTCGATCTCGCCGCGCATCTGCTTGATCACTAGGTTGGCGTCGCCGCAAA
TGATCAGCCGTCCCCTGTCTAGGTTTGATAGTTGATTGAACGCCAACAGTAGCCCGTCGTACTCTGCCTCGTTTACCGTGAGGTCTGGCGCATACTTTGT
TTCCGCTGCGACCGCAATCCACTCAGGTAGCTTCCATACAATGGCACTGCTCGCCCGTCCGCCGCTTTTTCCACGCGCCGATCCGTCAAAACTCACGACT
AAAACCTCCTCGCCTTGCTCAACCGTCGTCGGGGTTGCGGCGATATTTGAACGTGGGCGCTTGCTTGGTGCAACCGACGACAAGATCGAGTCGACGTTCT
CCCGAGGGGTGATACTTGCTGCAATGGTGCCCAGAATTTCGTTCTCTCTGCGCGTACACTTGATAGTCTCTAGCGTCCACGGCGAAACCAATGCTGCTCA
GTTGCCCAGCCGGCCCTGCAAACACAATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGCACCCTGCTCGAAAACCCGCCGTTGACAACCCTA
GGACTGATCGATCTCGTGATTAGCGTGGTGTAACACACGTCCAGTATCCTGAGAAGAGCCAAGATCTCCATCTCAACGGTACCGTAGTTCAACTCATTGG
ACCTCAACGTGCGACTGGTGAACGTTACAGACATTTACGTGCCGTCGTGTTCCTGCATCAAGACCGCCGAAATCGCCCAATCACTCGCGAAGACGACGAT
CACTGGCGTCCGAACGGGGTCAAAGTGTCTGGACACTGGTTCGTCTGCGATCTTGTTCTTCAGCTGTTAGAACGCTAGTCGCGCTCGGACCAATTTGTCT
GTTTCATCCGCCGAGGCGATCCGCTTCTCGCCCTCAGCAGCTCGATCGGGTTTCGGGTTCATTTCGTGAAATTCCACTTCTTGCAGTTCATACAAGATCG
ACGCGTAGATTGCGAAATCATCAATGAATCTGCTGTTGTAGTTAAGGCTACCAAGAAAAGTCTGGATAGATCACGGTGCTCACGGGAATGGCAAAACCGT
CAGAGTCTCGAGGTTCTTCGGGTGCGTTTCGAGGCCGTCCGCGGACACTCGATGTCCCAGGTAGTCTACTTGGCGGCAGCCCCATGATCTCTTCACCATG
CTGATCGACAAGTTCCAACGGTCGCACGCGTGTAGCAGTCGATCGATTCTGGTGCAGAGCTCGTTCCAGGATTCAGTGGTCACCAGAATGCCGTCGATGT
ACGAGCGACGTCCCAGCACAGGCGGTCCTGAATGTACGTCTGGATCACCGATCTTGAACGCATCCGCCATACCTGACTGGTCGCCTTCTTCGCGGATCCG
AAGATAGCCATACAATGCGTTGTCCAGATGTCGCTGGTAGATTTGAGGGACGTTCTTCAACCCAAAGCGCATACGCAGCCATTCAAAGAGACCAAACGGC
ATGACGAACGCCGACACCAAACGCACCCGCTGGGGTCGTCGACATGACCCAGAAACCGCTCGCCATATCTAACGAGCAGTACCAGAGTGCCTTATCTAGG
TCTTCCAACAGATCGTTGATCAACGACATGGCGTACACCATGAGACGTATCAGGCTGTTCACCACGCGGCAATCGATGCGGAGTCTAATGTCGACCCCAT
TCCTCTTGACAATCACCACGATAGGCGACACCCACGGCAAGCTAGACGTCTTTCTGATATGGGCAGACCCTTGATCAAGCCGGATAAGTTATCTCGAAAT
TGCGGCGCAACTCGACGCACGCGCTGATCCACTGGCTTGGCGGTCCCAGTATCGATATCACAGTAGACGCCTCGCGCGGCTGGCGGCAGGGCGTTCCCTT
CTCCGAGAAGAAGATGGTGTCGGCTTCAGATGATATTCCCCAACCTAACTTCATCCGCTGGCGCGACAAAGTCCTCATACTCGATTCGGACGTCTTCAAG
CTTCACATTTCCTGGCGTTGTCGTCCCCTCTGGCAAGATTACCAACTGAGCGTCTACGCCTTCGACAAAGCGTTTGCCCCCTTCGT