Description :
From Genome Similarity Track
Location :
contig_12:844679- 847429
Transcript NameFunction/comments
g4102.t1hypothetical protein

Sequence
2750 bases(100 bases per row)
ATAAAGCTGCGGGAACCTCAGCACAACTTCCTCCGGGATGTCCTGGTCGAAGATGCCGATTACAATGATCGGGAGCGCCAAGAAGAAGTTCCAGCCCGCC
ATCACGAAGCTCTCGAAGAGCGGAGCACCCGACTGCCCATTGAAGAAGTTGAAGACGAAGAGACTGATGACGAGAGCGATGTTCTTGTAGAACGAGTAGC
GGATGACCTTGCAGACCCGCTTGTAGTTGCACCGCCCGTGAAGGAGGACGAGTCTCGTGAGGAAGCGGAATTGGCGACGGCGTAGTCGCTGGCGTTCACA
GCCTGAACACCTTCTTTGCCGCAAATGCCCACGCCGACGTGCGCTGTCTGGATCATGCTCACGTCGTTGGCGCCGTCTCCGATCGCCAGAGTGATCGGCT
GCTCTCCTTTTCCCTTCTGGCCACTGCCTTGACGACCTCCTTTGCGTACGAGCTGAACGATGTCTGCTTTCTGGGACGGACTCACCCGACAGGCAATAAG
CGCCTTGCAAACTCTGGCAACATTCAGTAGTTTCTCGGTCAGCACCTCGACGCGTTGCATGGCTTCGGCAGACATTTTGAGTCGCGCGTCACGCGATGGG
AATATATGCACGAGCGCCTTGCCGTCGCAGACCATGGCCAGATTGTCGGCTACCTGGTCGCCTCGAATGAGTCGCTGTATCTCCGGAGATCCATGAAGGT
CGTCAAGCTGTGCACTCAACGCGTCGACGCGCTCGGCATTCACGTACAGCAGCTGCATTTTGTCGTTGATCAGCCGACAAGCGTGGCCGATGTTGATAGC
CGTCTCCTCCCGGTCTCCAGTGAGCACCCAGACCTTGATTCCAGCCTGCGCCAGGTCGAAAATGGCCGACGGCACTCCTTCCTGCAGCTTGTCCTCGATT
GCCGTCACTCCCAATAGCTGCATGTTCGTCTCGATCATCTCGGCGCTTGCATCCAGCTTCTCTTCGCGGTCTTCGAGTGCTGTCGAGGCTGCAATGTAAG
CTTCGTTGTACTCCTTGTATTCCTCCGCAGTAAGCACTCGTCGCCCAAGTACCAGCGTTCGCAGCCCTTCACGAGCGTAGTTCTTAAGGTGTCCAACCAG
TTTCGCGTGTGCGGCAGTATCGCCGTCACTCTTTCCTGGTGCAGCGCGTTCGAGCATCATGTTGTCGGCGCCCTTGCAGTACAAAACGTACTCGCGGGTC
TCTTCGTTCACCGCTACCACTGACATCCGCTTTCGCGTCGAGTTGAACTCGTTCACGTTAACGATCGTGTGGTATTTGGCAGTAGGATCGGGTGTCTGCT
GTGTGTCTGCAGTGTTAGGGGGGAGCAGAGACTGCTTTCGAGAGACCTCCACCTTCATGAGCGGTGCCGGCGCCACGAAGTTGTATCCCCAGGCACTTGG
CAGCCTTCACTAGAGCTTCCTCATCTGGTGATGACGCGCGGTAAGCAATTGCACCAGTCTTGGAATCTGTCTCGGGGATCACCGTGTGGCAAATCGACAA
GAGGGTGAGGAACTCGTGGATGAGTTCGCCTTGCTTGCCACCGGCGTACAGCGTTCGCAGCAGCCCTGGATCGTCGAAATGAATGCTGGGATCGAAGTGA
ACCTGGGCATCTTTCGGGTCACTGCCCTCATCGTTTAGCGCCACAGACTGCACGGGTGCTGCAGGCGATACCGTCTCGCGGATATCGTCGGTAGAGTCGA
TGTCGAGCCGCACTGCACTGCCAGCTCCGTCGGCGAGCGGGTTCACTTTTGCTTTCGCTGGAGATGGCGACTTGGCATTTGGTTTGGCACTGCCGCTAGC
GAGAGCAGCCACCGCTCGTCCGATCTCGGTCGTGCCGAAGCCGTACGAGATCCCACCGATCGAGCACTTGCGGAACTCCATGACGTTGCACGTCAACGTG
CCGGTCTTGTCGCTGAAGACGTACTCGACCTGGCCGAGCTCCTCGTTAAGCTCGGACGTCCGCGCCACTGCGTGCGTACCTTCGAAAACCATCTTGGCGT
CTGCCGTGATCCGGTTGGCTTGCAGCACCTTGATGATGTCGAGCGAGACGTAGAGCGAAATGGGCACGAGGTTGTTGTACAGGATGAGGAACGTGAAAAG
TTCACGACGAAGTCGCCGACGCCGTCCGCCTCTTTCATGAATGGCAAGTACCACACGCGACTGGCGTTCGCCTTGCTCCAAAACGCCGCTACTATCGCGC
TTGCCAAGCAGAGCAGAAACATGGTGCTGAAGATCAACAGCATGCACCGATTCGCTGTTCTGTAGAGTTTGCTCTGCTTAGATGGCGCCGCTCGGGAGTT
TTGAAGCAGCTTGGTCTCACTACCTGTAAAGATCACGAGACCCACGACAAAAGCGCAGCTTCGAAGACTGCAGCCACGGAGTAACAGGTTCTCGGGGCCT
AGCGGTACTGCTGTTTCGCCTCGGTCGCTCTCACGCAGTAGCAGTCGACCGGTAAATGTGTAGAGCTGGTTGTTGGGTTGTTCATGCTCTACAGACCCGC
GCAGCCGTCGCACGGCTGAAGCACACACGGCTTCCTGCGACAGAGGACTTCCATGCAGCTCACGCCAGCCTACAGCCTGTGCCGTAGGCTTGACAGCAAT
TCGTCGCTTGAGATTTGTCTCGCCGTCCAGATTAGACGTCTCAATGAAGCACCGGCCTTCCTCCTCGGACGTGGCCAGAATCACCAGGTCTGCTGGTAAC
TCCTCGTGGTTCTCCACACACACGAGCTGTCCAACCTGTAAATCTTGCCA