Description :
From Genome Similarity Track
Location :
Scaffold_128:84453- 88083
Transcript NameFunction/comments
Physo_143066reverse transcriptase

Sequence
3630 bases(100 bases per row)
CGAGCCTCTCCTCCGGTGGCTTGTCGAACTCGACACTGCTATTGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGCCTT
GGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGACTCTCTGATCCTACGTGCTTCAGCACGTACAAGAATTTCAAGGAGGAGCTCAGACAAGCATTTG
AGCCCCCGCAAAATGCGTTTGGGTCGAGGGCAGAGTTCCTCGACCTACAGCAGGGTAAGCACGATGTCCATACGTACACGCAGAGAGCACGGTACTTGGT
CTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGTCCGAGAGATGGGCCTGTAAAGACCTATCTCTTCCGTGAG
TACCCAGGCACTCTCGAAGCTGCGATTACTCTTGCAATGCAGGAGGAGTTTAGTCTGAGGCAGGCTAAACTGCATGCGAATGCGCCGAGGCTGCAACCGC
CTCCGGTCGCGATAGCGGGAGGTCCGGAACCAATGGACCTCTCGAATGCAACGGCCGTTGGTTATCAACAGGAACAAGAAAGTAATGTACGATGCTTCCG
TTGCGGAAGGATCGGTCACTACGACCGAGAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGCGAACGAACAAAA
AACGCTGGAACCCAATAGGCGCGGGGCGCCCTACTGGTGAAGCAGTCACGCATGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCCCAGTGAGGA
CCCTTCTCACTGCAAAATGCATGATGACAAACCGAACCTTGTCATCTTGAACGTGTCTTCGAAGAGAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCG
GGCGCGTCGGACAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGAGGTAATTATACCTCGAAGTATGTTGGAAGTTCGATTGGCAACGG
GTTTCATCGTTAAAACCGAAGAAGCGCATGGTACGCGTGCGTTTCACGCATGAAGATCAAGAGTTTGTCGAGACCTTTATAGTCCTGGATCTGGACGATA
AGTTTGACATTGTATTTGGCGTGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAAC
AGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTACGCGCGACTCACCACTCGAGACGGCGCCTAATGCCGCTGTCCTGGAGTGCCCTGGG
CGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAG
CGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCT
GGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGTATCCTCC
GTAATGGGGGTCTCCGCCAATGCTTGGCGTCGAGGCACTAAAGTCGCGACGGTTCCGGGAACCGGCGCTGCGAAAAGAAGTTTCGCGTCGACTCCGGGAG
TCGACGCACCCTTTGTAACGAAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGACGACGTGTCGGCTCCGGGGGCCGACGCTGCTGGCGGTGCGGACGG
TTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCG
CGGGATGAACCCGCCGGCGGTACTAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAA
GACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAAAAGCCGGACGTCGA
GACGTTGAATGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCA
GTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGAACGCATCGAGCAACTATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAG
AACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGCTTTGAAGAGCAAAGCTGGGACTCGTT
GAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAG
ATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAATGCGATCGACGACTTCTTCGAAAGGCGTCGCA
AAGCTGGACAGGTGCGGGAATCGAAGTCCCCGCACAGTGCCCAGACGTTCGGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATAACAA
GCTGACCGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGACCAGGAGCACTATCTACAGTGCTCTTGATGTG
CGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGACATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGC
AGGGTCTGAATAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGTGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGT
CCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGGACAAGCTCTATGCGAAT
CTGAAGAAGTACATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCGCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCA
ATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACG
CTTGCTGTCACAGCTCCTGAAGAAGGACGTCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCG
ATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGAGCACGAGGGCC
GTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCAATGAAGTACGCACTCGC
GAAGTTCCGAGTGTATCTAAGAAGAAGACC