Description :
From Genome Similarity Track
Location :
Scaffold_2:844511- 848182
Transcript NameFunction/comments
Phyca_LT1534538800tRNA pseudouridine synthase A, putative
Phyca_LT1534538803PREDICTED: uncharacterized protein LOC101260593
Phyca_LT1534538804ubiquitin-conjugating enzyme E2, putative

Sequence
3671 bases(100 bases per row)
tgacttgaaaaaagtatacttccatttcgtgtttcattggtgtaggcatggccgagtcggatgacttgtctccgagctggcgctattgtctgcacattgc
ttactacggcacaggcttcgtggggtggcaacgacaacaacaagagacgaaaagcagctcgggacacgacagtgtgcaggaagtcgtggaggccgtcgta
acggagatattggggacttcacagcgagtgaacgtcactggagtcagtcgtacggatgccggcacccacgcgctctatgtaggttattggtaatagctag
agaagtcttgaatggaactaaccggtgtgtccgttctagcaatttggcttcatccgactggacaaggaactgcacatgtccatggacgagctcaaggacc
gaatcaatgaaaagtaagtgggaagttgaacgtgaacggagcaattgactgatcggttggtgtggcagactggggaagcgcgtggtggtgcttggggtga
cggtgccgactacaggtccgtcgcgcattcggtcgcggtacaagaagtacatttactacttgcagcaaggacatcgaccggatctggagctgggcaaata
ctcgtggtttctaggcagaagactcgatattcagcggatccatgacgcgctccagtgagttgaaagtggatggttggagttggaacacaggctgacacgt
tacacgacaggttcttggaaggcacacacgacttccggccgttctctcaaggcttattgaagcaaaagtacgaggagatgaagacgatacgtacagtcgt
ctcagtaaaggtggtggttcgacggtacgtctcgcttttgagctctgagaggtgttagcccacattctaacgtcatacgtggacgatagcaatgtaaatt
tctcgctggatccacgagtgtgcggcagtggcgacgttatcaacgctgcagacatgtatcacgaaaacactaccgaaaagcacgtgtccgacgatagcaa
ggctgtggccacaggtgaccacaagaaacggaagatcgaccaagcgaacgaaggcgccccggtacattttgtttgcatcgagctggttgccaacggattc
cttcggcatatggtacggcggatcattggaactctgcggcccattgccgaaggcacccagccgccctcccgaatgcagcaagttctcgatggtgcagtca
aacccggtccatctgcgccaacaaaagctctctggttgcatcgaacctggcttacacaagaagaatacgacgcagattccggtacaatcgagtagattgc
aatagtaggaataaacaaccttaccaagattttagcttaggacgaccagtctatagctcttcgtgtccctcagcttcggaggctttttccagggcagcaa
catgctccaagatccgggtaatatgtccaaggacgatctttccaatgattgctggcgaatacttctccaccatgtctttgcgagcttgtttgcccttggc
aaccgcttcctgcgatggaagagaaattcaagagcgatatcatagtgagaacttcgctatgaaaacgtgaatcgttgcgttgcttacctctggatgctcc
ttaacccgaatcaaaagctccgtcaaatgtctaacggagggatcagcccacttatggcccttgaaagcaccttctgtgatctgttcaggtagcagaaata
catcagtccagcaactacgtagcgaaagccttcaaagtgcttgctcacctcgataagaccgtcaatctcgagtgggtacgaattctcctccgtcatgtac
tccgtcgtgccactccagaaagtcgcgatcaaaggccgctccatcgccattgcctcgacgtgaggccgtccccatccttcaccacgcgacggaagaacga
acgcatcggcagctttgtaaagtgatggcatcgcctcctgcgggatatgcggcggtagcacgtggatatgtggcagctcatccagtttcttgccaaccgc
ttccaaggaaaacttctcaatgactcccataaagtcttcagcagacgacgatgtcgtgtgatacccgttcgtaagcaacactaacaccacatcgtcctct
accttgaaagcctcgaagtacgccttcagcagaactctccacgccttccgttcttcccacttgaagatggataaatacactgtcgtcttctccgtcatct
caaacgccgtctcgcctgccaggtcgtacaccttctctaccttctccgggtcgaagaagtccacgtccacaacctcaggcacgactttcactgcttctgg
cttcactcctccgtcgacaaatatcttctcttggaacttagtgggtacccagatctcgtccatcttgttcatcctgtccggccatcccttgggcactcgg
tccgtctcgaacatggtgcgtccgaccttgtactgtgctttttcaggaggacaccgcgacgtcatgtagtgcgcaggcgcccacgctccaggctcagaat
ggcagatggccagagcgatcttcctgttcttcaaccgccagtagaaatccctctcctcgatccaatggtgctctaacttgctcttcatgtccgtaggcag
gtctcgaatgaacgatgtgttcaatgagtctccatgctgcgtaattagcagttcaaagggcttttccactaccttttcttcttgctcgacctctagatct
tcactagtagagctagaactggctgattccctactgcagtgtcaacggccacgacgtacgagtgcgcttcgctgcagtaacccccgccactgaggaaagg
agcgtaccagagcacagcaggaggtgctgggtcattgctgacgatcgggcgtcgtccaaaacctgctgtgggcgtcgctagcagcacacaaagagggaag
aagagcggcagcaccttcatggcggatgtattgacacaattttgacgttataacgttaaaatataagtcaaacaagataattgcattaagcctgctaatt
gttatttttgagatgtgcgtgaggtgtgcgttgatctactttgatataccgagtttaggacgcgtattgcttggtccagtcctgtgccgtcttctcgaag
tccgccttgttctcgtgcatctgcttggcgatgtcaggctccagcgggttgtccatgtccggttgctccaagatctgcttgattgcggtcaggcaatgca
gcacattcaacgtcggcccccaattctcattgatcacatcggcacagatttcaccggactgtgacttgacgttcgggtggtagactcgggtgaggaagcg
caccttcggcgccttgaaaggatattcactggggaactgtagatccaagttgaagacacctccagcatacggcgagtcctcctgtaaatcaaattccagt
caacactcgttgaaaggtattatcgggctggcaattgcacgtacggggccagcgagcatggcgttccagtgcatcaggtcgtcgtctacagcgctaactg
tgcaccattcgggcgagttcttctcaaactcggcaagctcctaagaacaagacaccagtattagcaggaacctaaggggaggcactagacagatatacag
ctcgcactttagtgagacgacgggccatggcgagcagcagaagcggaggaagctgggggtagctggatgat