Description :
From Genome Similarity Track
Location :
contig_12:844511- 847261
Transcript NameFunction/comments
g3922.t1hypothetical protein

Sequence
2750 bases(100 bases per row)
ATAAAGCTGCGGGAACCTCAGCACAACTTCCTCCGGGATGTCCTGGTCGAAGATGCCGATTACAATGATCGGGAGCGCCAAGAAGAAGTTCCAGCCCGCC
ATCACGAAGCTCTCGAAGAGCGGAGCACCCGACTGCCCATTGAAGAAGTTGAAGACGAAGAGACTGATGACGAGAGCGATGTTCTTGTAGAACGAGTAGC
GGATGACCTTGCAGACCCGCTTGTAGTTGCACCGCCCGTGAAGGAGGACGAGTCTCGTGAGGAAGCGGAATTGGCGACGGCGTAGTCGCTGGCGTTCACA
GCCTGAACACCTTCTTTGCCGCAAATGCCCACGCCGACGTGCGCTGTCTGGATCATGCTCACGTCGTTGGCGCCGTCTCCGATCGCCAGAGTGATCGGCT
GCTCTCCTTTTCCCTTCTGGCCACTGCCTTGACGACCTCCTTTGCGTACGAGCTGAACGATGTCTGCTTTCTGGGACGGACTCACCCGACAGGCAATAAG
CGCCTTGCAAACTCTGGCAACATTCAGTAGTTTCTCGGTCAGCACCTCGACGCGTTGCATGACTTCGGCAGACATTTTGAGTCGCGCGTCACGCGATGGG
AATATATGCACGAGCGCCTTGCCGTCGCAGACCATGGCCAGATTGTCGGCTACCTGGTCGCCTCGAATGAGTCGCTGTATCTCCGGAGATCCATGAAGGT
CGTCAAGCTGTGCACTCAACGCGTCGACGCGCTCGGCATTCACGTACAGCAGCTGCATTTTGTCGTTGATCAGCCGACAAGCGTGGCCGATGTTGATAGC
CGTCTCCTCCCGGTCTCCAGTGAGCACCCAGACCTTGATTCCAGCCTGCGCCAGGTCGAAAATGGCCGACGGCACTCCTTCCTGCAGCTTGTCCTCGATT
GCCGTCACTCCCAATAGCTGCATGTTCGTCTCGATCATCTCGGCGCTTGCATCCAGCTTCTCTTCGCGGTCTTCGAGTGCTGTCGAGGCTGCAATGTAAG
CTTCGTTGTACTCCTTGTATTCCTCCGCAGTAAGCACTCGTCGCCCAAGTACCAGCGTTCGCAGCCCTTCACGAGCGTAGTTCTTAAGGTGTCCAACCAG
TTTCGCGTGTGCGGCAGTATCGCCGTCACTCTTTCCTGGTGCAGCGCGTTCGAGCATCATGTTGTCGGCGCCCTTGCAGTACAAAACGTACTCGCGGGTC
TCTTCGTTCACCGCTACCACTGACATCCGCTTTCGCGTCGAGTTGAACTCGTTCACGTTAACGATCGTGTGGTATTTGGCAGTAGGATCGGGTGTCTGCT
GTGTGTCTGCAGTGTTAGGGGGGAGCAGAGACTGCTTTCGAGAGACCTCCACCTTCATGAGCGGTGCCGGCGCCACGAAGTTGTATCCCCAGGCACTTGG
CAGCCTTCACTAGAGCTTCCTCATCTGGTGATGACGCGCGGTAAGCAATTGCACCAGTCTTGGAATCTGTCTCGGGGATCACCGTGTGGCAAATCGACAA
GAGGGTGAGGAACTCGTGGATGAGTTCGCCTTGCTTGCCACCGGCGTACAGCGTTCGCAGCAGCCCTGGATCGTCGAAATGAATGCTGGGATCGAAGTGA
ACCTGGGCATCTTTCGGGTCACTGCCCTCATCGTTTAGCGCCACAGACTGCACGGGTGCTGCAGGTGATACCGTCTCGCGGATATCGTCGGTAGAGTCGA
TGTCGAGCCGCACTGCACTGCCAGCTCCGTCGGCGAGCGGGTTCACTTTTGCTTTCGCTGGAGATGGCGACTTGGCATTTGGTTTGGCACTGCCGCTAGC
GAGAGCAGCCACCGCTCGTCCGATCTCGGTCGTGCCGAAGCCGTACGAGATCCCACCGATCGAGCACTTGCGGAACTCCATGACGTTGCACGTCAACGTG
CCGGTCTTGTCGCTGAAGACGTACTCGACCTGGCCGAGCTCCTCGTTAAGCTCGGACGTCCGCGCCACTGCGTGTGTACCTTCGAAAACCATCTTGGCGT
CTGCCGTGATCCGGTTGGCTTGCAGCACCTTGATGATGTCGAGCGAGACGTAGAGCGAAATGGGCACGAGGTTGTTGTACAGGATGAGGAACGTGAAAAG
TTCACGACGAAGTCGCCGACGCCGTCCGCCTCTTTCATGAATGGCAAGTACCACACGCGACTGGCATTCGCCTTGCTCCAAAACGCCGCTACTATCGCGC
TTGCCAAGCAGAGCAGAAACATGGTGCTGAAGATCAACAGCATGCACCGATTCGCTGTTCTGTAGAGTTTGCTCTGCTTAGATGGCGCCGCTCGGGAGTT
TTGAAGCAGCTTGGTCTCACTACCTGTAAAGATCACGAGACCCACGACAAAAGCGCAGCTTCGAAGACTGCAGCCACGGAGTAACAGGTTCTCGGGGCCT
AGCGGTACTGCTGTTTCGCCTCGGTCGCTCTCACGCAGTAGCAGTCGACCGGTAAATGTGTAGAGCTGGTTGTTGGGCTGTTCATGCTCTACAGACCCGC
GCAGCCGTCGCACGGCTGAAGCACACACGGCTTCCTGCGACAGAGGACTTCCATGCAGCTCACGCCAGCCTACAGCCTGTGCCGTAGGCTTGACAGCTAT
TCGTCGCTTGAGATTTGTCTCGCCGTCCAGATTAGACGTCTCAATGAAGCACCGGCCTTCCTCCTCGGACGTGGCCAGAATCACCAGGTCTGCTGGTAAC
TCCTCGTGGTTCTCCACACACACGAGCTGTCCAACCTGTAAATCTTGCCA