Description :
From Genome Similarity Track
Location :
Scaffold_216:8445- 9546
Transcript NameFunction/comments
Sapdi_VS20SDRG_17212hypothetical protein

Sequence
1101 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGACGTTCAAGCTGCACTTGGCGAGGGTGCGCCAAACGCCAATCGACGCTGCAAGATGTACATCTTCTAACTGCAGT
TGTGAGTCTACCATTTGTAGTAGATGAAATGGTGCATAAAAGGCATGACGTTATTGCTTCGTTCATGTCTCCAAACTGTTTACTCACAATATTTACTCAC
AATAGCTTGTTATTTTACATGGACTCTACCTATAGAACGCCCACCTCATGGGCTCTCGCCAGCAACCCGCGCAGCAAGGTCTCTTCATACTCGAGCGCCA
CGTCCAGTCGCCCCGGAGGAACCGGTGCGAAGACCAAGTATGGCTCGTGAACCATCGGCTGCCCCGTCTCGATCGCTGTGATGGCGCGGACCAGCGTATC
GATCGCTGCAACGCGCTCGTCTGGTGTCCAGAGCAGCGGCGGCGCGTGCAGGAAGTTGCCTGTCCGAGGAATGCGGTGCAGACTCGGAGCTTGCTGAAGA
ATCGCTTGCTGCATGAGCGCCATTGGCGACTTGCTTTCGGAGCTCTGTGCGTCGGTGTCAGCTTGGGCGGCGGCTGAATCAGCCACAAGTGTTGGCGCCG
GTGTCATCGAGGTGCTTGGAATGCTGTCAGTTGCGTCGTCCAGGGTCGTCGTCGTGGTCTTGGGCTCGGTGGCTTGTTGGAGACGTGCAATGGTGGCGTG
TTGCTCGTCAATGGTCCGTTGAGCTGCCGAGAGCTTCGTCGTGAGCTCTGTGATTCGGGCTTGTGCAATCTCGAGTGGCGTTGCAGCCTTCGAAACAGGC
GCAGCTGAGCGCACTGTCGTCGTGGCAGCGGCAGCTGCCTTCTTGCGATGGTCGACCACCGGCTTGGTCGTCTTGATCACCGNNNNNNNNNNNNNNNNNN
N