Description :
From Genome Similarity Track
Location :
Scaffold_11:844303- 846821
Sequence
2518 bases(100 bases per row)
TTGACTTTCTAAAAGGTTTTTGGCAGCTCCCTTTGGTAAAGGAGTGTCAGGCGTTTCTTTCGAACATGACGGATAGTAAAGTGTATACACCTACCCGAGT
GCCACAAGGATGTTGTGATGATGCGGTCCATTTTCAGCGAACGATGGAGACGTGTTTTAAGAGATTACTGTACAAGCACCTACTAGTCTGGGTAGATGAC
CTCCTACTGTATGGTAGCAATATTGGTGAGTACCTGGAGAAGCTTCAAAACGTTTTTCTTTGGTAAACGACTTCGGTTTGAAACTGAGTGTGAACAAATC
GAGTCTATATCAGAGAAGCGTGGAGTGATCTGGCAAAATGTTAGATTGCGCTGGAGTAACGCATGACAAATGAGCGCATACGGTGACTACGGGAAATGCC
GTACCCGCTGACTGCTGCAGACCTACAGCAGTCCTTGTGAACAACTAATTGGCTGCGATAGCTACGCAGTAGCTGTGAAGCCACTTCAGCAGTGTTTTGA
CGTTGCACTCCGGAGCAAAAAGAAGTCGAAGCGAGCTGCCGCCGTGGTGCCTATAGTGTTTGCTGCTGAACTTCGAGTAGTTTTCGACAAATTCCGTCAG
TTGCTAGCTACATCTGCTACTCTGTACGACCCCAGTGCCAATTGAGACATAATGCTAGCCACGGATGCCTCTGACCAGGGCTGGGGCATTTTAGTGACTG
AAGGTGAGAATTGGGACTCTACAAAGCACGTAAGCGAGCAGTCTCACCAACGTTTAACGTGTCTAAGTGGTATATTTACTGATGCTCAAGTGAATTGAAG
TGTAATTGAGAAGGAAGCGTTCCCTCTAGTCACTGCCTGCGAAACGTTACAGTATTTAATGATGAGACCGAGAGGATTTTGGATGTTCTGCGGTCACAGG
AGTTTGATACATGCATTTGCGCCTGCGGAGAATATCAAGAAGCATATTCGTGGTAAATTAGTTCGCTGGGCACTGAAGGTGGGTGACTTTCGGTACACTA
TCAATCATATCGCTGGGGTCGCTGGCGTGTGGGCTGATATGTTGAGCCTATGGGCTTGCCAGCCAACAGAACCTGTTCACATGCGCCGAGTTTGTACCCG
TCGGGCCCAACAGCAGGAGCAAAGAACGCTCTGCCCTCTGGACGATGAAAACATTGTATGGCCGACACTTGACGCCGTGTCGCGGGCTCAAAAGCGACAC
GCACCGCGGCCATTACTATCATGGCTGGTAGAACGGTCTGATGGACTGCTAGTAAATTACTGTGGATACCACCCGAAGAGCATGCATTGCTGCGTCGGCG
GATGATTATCTTGCATTGTGAGCCTCAAGGCCATCGTGGTCGGCATGCAATGATGGCCCTGTTGGCCAGTGTGTTCTCGATTGAACGGCTCCGTGTGCAC
GTAGAGCGCTTCCTGGCGAAGTGCCAGCTGTGTATGCACATTAAAGAACGGGAGATCATTCCGAGTCCACGGGGAGATACGTACCGTAACCAGACGTGGA
ATGAAGCGCTACATTCTGACTTTTTATATATAGGTTAATCATTTGGCGTCAACCAGTACCTACTGACCCTGAAGGACGATTGTAGTCATTTTTGTGAGTT
AGTAGTCTGTGTGTTACCGACCAGTGCCGTGGTCGCCGAGGCTATTCTACAGTAACATTCCTGCCGCAACTATGGATTAGTGACGAAGTGACGCACTCAT
TTCCTATGTGAAGTGGCTGACACCTTGAGGGGTAAGCTGAAGTGCGATCACAAATTTTTGGTGGCATATTGTCCGTGGATTAATGGATCTATTGAGCAGT
TAAATGGGATATTCTACAAGTTTTTAGAGTATGATTTGAAGTACAAACTGGATCATCGTGACGGAGAGTCACTGGTCTCTGTAGTACAGTCTAGCTTGAG
CCACACACCTCTACCCTCGCTAGCCTACAAGTCATCACTGAAACTATTTACGGGGCTGCCGCCGCCGTCACCTTTTGGCCATGCTTTCGTACGCAATCAA
GGCCAAGGTGAGATCATTAAGGCTGGGAGCTCTGACAAAATTGAGCGCTCGCTGGCGCAGCTACCTGCTACTATTCACAATATGCACAGAAATGTCAGTA
ATGCGAGGAGAAGCAAACTTTATTGAACAAGAAGGAGCGTGGAGAAGACTTAGTGAATTTTTCGGTTGGAGATTTTGTGCTACGTTCTCGAGTGGATGAG
AAACACGTGAGCAAACTTCTGGTTACTTGGGTAGGGCCGTATGTGGTGACGGAGGCTCACTCGAGACATTTCGTGGTTAGCGATTTAGTGACCGGCAAGT
CACGCGACGTACCCGCGTCACGGTTGAAGTTCTTTGCCGATAGTGACCTAGAAGTAACTGGAGAATTGCTACTACATGTGACTAGCTAAGGTGTTGTGCT
CGATGTGGAGACGATTAAGCGGCACCGTTGGAATGTACAACGAAAGGACTACGAGCTCTACGTTTGTTGGCGTGGTATCGAGAATATTGAGAATTCCTGG
GAGCCATTTGCTGCTATG