Description :
From Genome Similarity Track
Location :
Scaffold_549:8443- 9684
Sequence
1241 bases(100 bases per row)
CGAAGAGTTGTCGGTCGATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGCTGAACTCTTCT
TCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAACAGCACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGACCCTCATGATCCCTTTTATTCCTT
AGTCAAGGAATTTCAAGATGTGTTGTGCCACGACCCACCCTCGGTTCTATCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTATTTCCTGGGACTAAA
TACTGTGTCACACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAAGTGCCAAGCACGAGGCAGGAATGGTACGT
GAGAGTAAATCTCCACATTTGACACCGACATTTTGTGTCAAAATGCCGAACGGCAAGTGACGTATTGTGCATGCTTATAACAAGCTTAATGCGACTACTA
TTCCGGTACAGACACCCATTATTCGAAAGGATGTTCTTCAGAACAACATGGTTGGTTGTACTATGTATAGAGAACTCGACTTGACCGATGGATATTACCA
ATTGCTCATGCGAGCGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATACCCCAAGGGCTGTCTAATGCT
CCGGAAATATTAATTTTCTGGTGACGCAACTTGTCCACCCACATCGGGATTACGTACAGACGTACTTTGATGGCATTTTTGTCTATAGTCGTGCCAAACA
AGGTCGGTCAGATGTTGAAAATCACATCAGTCATTTGCGAGCCGTGATCGAGTGCATGCGCACTAATAAATTGTACTTCAACGCGTCTAAATGAATTTTT
GGTGCAGAAGAGATTCCTTTTCTCGGATATTTCATTGGTAAGCGCGGCCTTCGAGCGGACCCCGCTAAGGTAAAATCTATAGTGGACTGGAAGATTCCTA
AGAATCAAAAGGAATTGCGTAAGTGGTCTGGCCTTGCCAATTACTTACACAAATACAGTGAAATTTACGCTGATATGGCTCTTCCATTAACTGATATCCT
TAAGAAGGACATAGATTGACGCTGGGACAACACCCATGCCGACGCATTTTGGTCATCAAGGAGAGTCTTCTCCATGCTCCCATTTTGGCGTTGCCAAATC
CTGAGTACCCTTTTAAGTGTTGGTCTGCGATGCATCCGACT