Description :
From Genome Similarity Track
Location :
Scaffold_2240:844- 3094
Sequence
2250 bases(100 bases per row)
TCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTCCTCTTCTACATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCT
CAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTTCGTCATATCCACGCCAATACACTAGAAATCCACGGTAAATC
CGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCCTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGA
GGACTTCGTCGAAATCCACGCGGTCGGATACATCCACTGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTAC
CACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCT
AATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGACATCTTCGTTGTGTCGATCCG
CTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTACTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTT
CCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACTCCGGATCCTGTCT
TGGGCGGTGTTCATCGCGAAGAAAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCT
GCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCGATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCGGA
CATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTA
GACGCACTAGCTTTGGCTACCACGTATCCAATAAATAGGTCCACCCAAATCAACAATTATGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGAT
CCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGAATCCCCTTTGATGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACCCCGA
CATACCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGC
ATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTAACTCTCTTCGTAGGGGGGCAATAG
AAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACT
TCTTTAGTCCCACGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGA
TCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGA
TCCTGATGCCCGGCTTTTCTCTCCACTTCGACACCACATTGATTTCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACAT
GCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTG
TCTGATTACCAAATTTGAATCCTTACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCA
TTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTA
CACGAGCGGATCAAATCGAAACTCAGGGCGTATAGATCCTCATCCACCTG