Description :
From Genome Similarity Track
Location :
Scaffold_236:844- 2753
Transcript NameFunction/comments
Phymu_g7283hypothetical protein

Sequence
1909 bases(100 bases per row)
GGAGGATTTGCATAATTGGTCTGTCAGTGAATTGCATCGCCATTGTCGAGAGCAATTGAGGCAACTTGTCAGGGTTTTTAGCGCTGAAGGTGTTCATGAA
CGCTAGCCACGTGGTGAAGAGGGGGTTCGTATCAAGGTCGTTGACTAattttctgcttggcagACCCAGCAAGTTGTAGACATCGTCGACGGATTTCCAA
CTTCTCAACCACATTTGCAACTGCGCAGTTTCCAACTCGGTCGCGATTTTCTTTGCCTTCCAGTCGTTTGCCTTCACTGCAgccagcatcttggccactT
TTTCGTCGCCGAACGTCTGTGTGAACGTTTCGATCATTGTCGTCTTCGCCTGAGAGAATTTCACATTGTACGCATCCGTGTACTTGGCCAATAAACTGAA
TAGGGGGCTCTCCAGCGTTTTCGTGGTCGCCTCCAGTCGGAGCTCAGTGAGAACTTTAGCTGGCGTTTGCTTGTCGTTAACCCAGAAATGAAGGAACGCG
TTCTCCAACTTGAGGCCCACACTCTGCAATTCATCAACGCTCTTAGCTGCTTCAGCCATTATGAGCAGATCTCCATCATTGTAGTGCTTTCTCAGCGTCG
GGATCATCGATACGGCTCCCTCGTGTTTTGCATTCAAATCGTCCACGTATTTTGACCAGGCACTGAATTGAGGgtctcgaagaaggcgcctTCCTGCGTA
GTTGAGGTCGTAAAGCTGGTAGACCTCACTAGGGTCCTTCCCAATCGTTACCCAGCGCTCCAACTGGTCCCTTTGCAGTCTCGAGGCGAGTTCCTTCGAG
CTTGAGTCAGTCTTGGCCGCCTTCAGTATTTTGTACAAATAGTCGTCGCCGTATTGGGCCGTTAGTGTCGAGATCGCGGATGTTCCCTTCCCGGAAGCGG
TGGCACTCAAGTCATCGGCGTATTGGACCCATTTGCTGAACTGAGGGTTGCTGAATATCCACGTGCGAgccttcgccagcttcatgcgATAAAACACATC
TTCGGCAGATTTTCCCTTTTGGAGCCacttctggagctgttcatcCGTCACTTTCGAAGATTTAAAGAGGGTCGCGAGCTTTTCAGAGGTAGAGACGGAA
ATTGCCCCTCCCGCTCTCTCTTCATCGAGAATACTTCTTGTTCGTAAAGTTCTCaaggcagaagcagcagtgtcaTGTACAGTGTCCGTAGCTGGAGATA
CCGCCAATAAAGTATCCGAAGTGGCGACGATGGATATGACAATAGCGATGATCACCAGGTAGTGAAGACGCATTGCTTGGTTTTACTGCTGGACAGTGTA
TTGCGATATGATCAATGCTACAATGTTTGCATCGAATCATTGATTCATCACAATTCAGATCTTGAGATGTGTGTACATTGTAACGCAATCCATGATTCGA
CACGATAATCCTGAAACAAACGTGATAATTTGATCGAAAAACGATTTTGACCAACGATCGGTAGTTCTGAAAGCCACACCACTAACGACTGGAAACAGCT
CTCTTCTATGATGAAGATCCCACGATATTCTTGGGTCTCCGTGTAATGTACGGGAGCCTCGTTGGACTGGGGGTTGGAGAGATCGAGACGGAAGAGTTCC
CCATTGTGCGGATCGGTCGACGTGGCTCCTGGTACTCGTGCAGTTGAAACGCCATTGGCTGGTGAGCTGGTGCaatttccagcagcttccgactTGACTT
TAGCGGCAAATAACTTGGATCCTGCTTCCACTGGTGTTCGACTAAAGGCGGCGGTGGTTGTCTGGGCGACAGCATCAAGTCTGGGGCGAAAAAGGACTCG
AACGTGCGTGTTGGCGGTGACACAAggtcgaactcgtcgtatTGGCTGACGCTCTTCAGTGTCACGTGGCTGTTGTTATTGCTTCTATTGCTGCCTCGCC
AAGACGGAA