Description :
From Genome Similarity Track
Location :
Scaffold_23:84366- 89026
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.46Protein phosphatase 2C
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.713'5'-cyclic nucleotide phosphodiesterase

Sequence
4660 bases(100 bases per row)
TGCGCCAGACGCTCGTCATCGGCGGACTCGGGCTGTCGATGCTGGCGCTTGCCCAGGCAGAGTCGTGCTCTGTGTCCGCGTCAGGAGACGCACGCTGCGA
TGCGCGCTTCAcGCCcGCGTaCAGTGGAGAAGATGTTGgTGACTCAATCGGATTCACGCTGCCACTTGATGGGGAgAAGTTCGAGTCCGTCGCGTCGTCT
CGCGTCGCGCGCTTCAGCTGTGCGACCTACAAGGCCAACTTCCCTATTGAAGACAaGTTCGACGTACAGGCGACGAAGGATGGCGACGTGTACGCGCTTG
TTCTCGACGGACACGGTGCGTTCACGTAGTCTCAATGGGATGTAtGCATGTATTCTGACGATAGGACCATCAGGCGGCTGGCAGGTGTCTGAGTATGGGC
GAAAGGTGCTCATCGAAAACGTCAAGAAGGAAGTGCAGCATCTTGCGAGCAAGAGGAAGTACCCACAGGACGCTGAGGTGGGATCGGAGGCAGCGAACGA
CGCTATCGCCGGTGCCATTCAACGCGGCTTCGCGCGAACGGATCGGGACTTGATGTCGAAGGTCTCGGCGGCTTTCCAGCTTGGGTTCGGTGCCGTGGGT
CGATGCGGCTCGTGTGCGCTCATGGTGTATGTGCACGAAGATACTCTCCATGTGGCCAATGCCGGAGACATCCGTGCCGTGTTGGGTAAGAAGACCCGCA
ACGGGGACTTGTATGAGGCGGTGGCTCTAACGAAGGATCAAAACGCCATGTCGTTGGCTGAGCAAGAGAAGCTCAAGAAGGAGCACCCTGGTGAGGACAA
TGTCTATGTATGCCGACGTCCAGACTCATGTTATGTCAAGGGAGCGCTTCAGCCAACGCGTGCGCTTGGTGATTTCGCCCTCAAATACTCTGAGTTTAAC
GGCCCACCATACGTGAACGGAGACCGATCAGCTGGTCGACACATCTCGGCTCCATACACACCGCCTTACATCACTGCAATTCCCGAGATTCGATCCCAGA
AGCTCCATGCGGACGATCAATTCGTAATTATTGGCTCGGATGGCGTGTGGGACTTTTTGACCAATGAGGAGGCAGTCGAAGCCGTTAGAGAGCAGCAAGC
GAAGGGAACCCcTCATCTAGCTGGACGCGCTGTTGTTGAAAAGACGTTGCAGAAAGCAGCGAGCCGATATGCAATGTCGTACTCGGACCTCCTGAGTCTT
CCACCAGGCAGCCACCGCCGCCGCCGCCATGACGACACGACTGTTGTTGTTGTGTTTTtCGAGTAAATGCTGCTGTCGGTTCAACACGGTTAAAAGAAAA
TATTAGAACAAATTCGTTGGACGGAGGAGACGTTCCTGGCAGTACGCTTCAAGTTTTCTCTCTCATGAGTTAGGACTACGACAGTGTTTACCTCTGTGGC
AATGACAACCcTCCACTGTTTCGATGTGGAAGAGAGCGGATACtGTTTTGGTGACGCATGCTACCATGATGgTGGGgTCGCCCTTGGTCTCTGCTCGAAG
GTCGATCAGTCACATGAGACAACGCTGATGATGAACCAAGGCTAGTACTGTTGGTGTGAAAGTGATGTTGTGAATGATGATGCGGAACCTCTTGGGCCAC
CACCGATGGAGGACTGTGCGAAGGCTCCACGAGCACTTCGGGATTCTGTTCAGCGATCCGACACTCGTCCAGCAGACGTTGATAAGAATCAAAGTTCTTT
TCCAGCTCATCTGCGTAGAACTGACTCCATGCATTAACCACCAAGTATCAAAGTAGGATCGTTCGCAAGTGAAGTACGAACCCGAAGTTGATGGCAGAGA
GATGTTAGAGGAAGCCATATTGGGCGGGCGACGTAGTTGATTAAGTTGAGCTGGACGATCAGGCGGTTCTTCTTCTTGGCCAGATTCTGCATGAAGAAAT
CACTTGAGACACCCTGTTCGGCCTCCACTTTCGCCTGTGTCTGGAACTCATCGAGCAGTCGGTTGCCCCACTCATAGGATTCCTTGAAGGGAAGGGTCTG
GTGGGATAAGTCGGCGGCATGCATCAAGATCCCCATAAGCAGTGTGCGTTTTtCACTTAGCTGACGTCGGGTCAAATTCTCcAAGGCCTTGCATTTCTCG
AAGTGTTTTGACATATCGGTAGAGAGAATACAGTTAATTATCAGCTGGCGGACTCGCTTGTAGCGGTTTTCGTCCAGGTGCTGCAAGATCTTAGCCGACT
TGTGGTTCAGAATAATAAACGTAACACGACAATGGTGGCGTTCCAGCACAGCATCATCGTTGTGAGTCAGAGCCATTGGACTTAGAGTTCTCAGCTCAAA
GTCATTTGTGTTGCCTGGATGATCAATATCATGACACAATGCCGCGATCAGCATGGCGAATATTTCTACGCCACTGAAGAACTTGCGGCATTCGTTTTtA
ATCATTACATGCATGGTCAAAAGTaCTTGAAAGGCATGCTGGAAATTGTGAAAGGCATTGCTGCGATAATAATTCGCAACGTTGCTTGTGAACGCAGCAA
ACTTCTCGCTCGAGATGCGAAATGCATCAAGAAaTCCATAGGCACGAAAGACATTTCCGCAATGCATGGCGATGTCGCTGCTGCCcATAGATAATGTGTC
CGTGTCCCATTTGTAAAAATGCTCATCAGCTCCAGTTGGGAAAATAATCTCTCGTGGAAACGGAATCGCGTCGTCTTCTTGCTTTTTCTTCAGTAACGCT
GGTACAACAGATGCGATTGAAGGCGGCGAAGACCCAGTATGCTCTCCATCACTCGTGCTGCCACTGTAGTATTTGTGAACAATGGAAGAGATGATATCAG
GCTCCGTTAGTCCGGTGTTTGGTCCACTTGGCTCAGTCAAATGGTTGCAATCGTAGACAACCTTGTAGTAGGAGATATCCAGAGACAAGCGACCCAACGC
AAACTGAACCTCACGACAGTACTTTTCCATGGTCACTCTGTCAGTCTTATTGAATGCAACGACGTGGGACCCTTCTTTCTTGTTGATGCACATCGCAACA
GCGACAACTgTtGGTGTACTACTCGCCGCATGGTCTTCGAaGATCGGCATGCACAGCACACTTGTTGTGCGATAACCCGTCTTGGCGTCTACACTGGGAT
CGAAAaGTTCGTGTTTGTAAGCATCACGGGTGCATACCACTTGGCCAGTCGTTGCTACCAGTCCGGAGATTCCGCGATTCATCGGCGTCCGGATACCACC
CTCACTGCTACTACTTCCTCCACCACTACCCACGACTCGTGGAGTGATCCAGAGTTCCTTCTTGAAGTGGTCAATAAGGAGGAATCCAAAGCGGTCACAC
TCCATAATAtCCTTaCCAATTTCCATCACCAAGTCAACGAACCGCTCAATGTCAGCACTCTCGGAGATGAATGTCGTGAGTTTCAATCGTGCTTCGATCA
GCTTTTGCGCAGTCTTGACTTCGTGGTGTAGCGTTGCTTTGTGTAAAGAGATCCCGACGGCTTCCGCTGCGTAGTTCAAAAATACGGCATCTTCGCTTGA
GAAGTCAGTGTTGTCGATCTTATTGACGGCCGATACGACCGCAAGGATCCGGCCGTCTGGAGATTTGACTGGGAGACAGAGGATGCGTTGCGTGACGAAA
CCGGTCTTGCGATCCAATGTGGGATCAAACAGGGGATGGTTGTATGCGTCGTTCGTAATCACTGTCTCGCCAGTGCGCGCAACGTATCCAACAATACCCT
TGGTTATTGGAACATATTCTCCTCGCACGATGTCGGCTGCACACGCGATATACAGCTCTTGTTCTGCCTCATCATCACCGTCGACTTTCAGAAACAGCCC
AATCCGTTCTGTTCCAATCAGTTCATGGCAGACTGACAATACTTGGTCAAGTACTGAAGACGACACTGCTTCCATCGAAATATTGCGATGCAGCTTCAGT
AATCCTTCGATGCGACTCTGCGCAGTTTGTCGCTCGCGAAAGAGGATCAAATTCCAGATGGCTGCTCCCGCcACAACAGCGAGAAACCCcaGACTCCTTT
TGTCCACATCTGTAAAGACTTCAGGTCGTGCGCTGCTTCCGTCAACAGCATCTTTCGATCGTGACCCTCCcGAAGGTGTTGTCGGCGGTGTCAGGAGTCG
TTCATGTGTCGTGCTGCTGTTGACCATAGTGATGACTTGAAGGACACCAACAACAGCGCCATGAGCGTTGCAAaTGGGAACGCACAGGAGTGCCTTGGGG
CTTACCCCTTTACAGCCACTCTTGATTTGGTCGTCGTAGTTTTCATGAGTGTAGAAATCTTCGATGTGCAGTGGCTTCGCCGTCATGATGACCCGGCCAA
ATGTCGTCGCGCTGTCAGCCGCCACAAACCCTTCCGCCATGTAAATAGCCGCTCCAGAACTTGGAGAATCAGCCTTTAGCTTGTTGGGACTAGGACCGAT
ACCGAACGTTGAGAAGATCCTCTTCCGGGGCTGTGGAGGAGAGTCTGAGGACGAAGTTGCTTGGGTCTTCCTCCACGGCCCTGCAGAGAAGATCTCCACG
ACGTTCCGTCGTTCATTTAGGAGTCCAAGTGTGTACTTGTCCGCCcGAACGAGCATCTGAGCGGCGCCAAGCGTGCGTGCGATCACATCCTCGAACTCGC
CCTGGGCCGAGATCtCTTTGACGGACGTCATGACTTCCTCCAGCTGAGCGACGCGCTCCT