Description :
From Genome Similarity Track
Location :
Scaffold_1070:8434- 10177
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1070-snap-gene-0.5Gene of unknown function

Sequence
1743 bases(100 bases per row)
TCACAAAAGCGAACAAGCGCGCAACGCACAGCCACCCGATTGTCCAGCGAAGTGAGTGGAAGTAGTATCAAGCGTAATATTTGCTTCGATGGTCTCTCCG
CATGTATCCTCGAAAGAGGGTTCACTTCTCTCTATTTAACTGCGCCAGGTCAAGTACAGGGCCTTTCCCTCCTTCAGTGTATCCAGGCGCGCACTGTGGC
GATCGGTGCGAAGCGCCGTCGTTCCCTCCGCTCCTNNNNNNNNNNNNNNNNNNNNNNATCATGCGCTTTTCGCATGATTATGCAAGACCAGGGGATCCAG
GGATAGCTCCAGCACCGCTTCCGTCAATTGTGGGTGTCACACACCCACAATCGCCCAGTCTGGGTTNNNNNNNNNNGTTCATTTCAGATCCAGTCACCAT
GGTATCCGTTTACATAGGTAGTAGATACTGAATAAAACTTACATACATCATAACGGGAACGTAAACAATGCTCATTTATCATTTCATGAAGGCGAATAGG
AGAGGGGTTTATACTGGACAGCTCACCCGCCAAAGCGAAGTGAATGGGTTCTGGGTATATTCGGTACCCCCCTCACAGGCGCCATCCTCCGCCACAATCA
GTTCCGCGCACTCAACAGCAGAGAAGACGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGAGCAGGGCGTCTGGTCCAAGGACGAGCACGACAAGTTCCTCGCCACGCTCAAGAT
GTACCCGCACGGGCCATGGAAGCTCATCGCCNNNNNNNNNNGGCACGCGGTCGCCGCGCCAGGTACAGACCCATGCGCAGAAGTACTACGAAAAAGTTGC
GCGTCGCGTGCGCGGCCTGCGCAAAAACCGCAAGAACCTGGCGCGCCCCGAACACCGCATTGACGACGAGCTCGCCACGCTCTGCAAGAAGAACATCATC
GATCGCAGCCACGCTCAAGTGACCCCCGAGAGCAAGAGCCAACCGCTTGCTGCGTGCGCTGTCGTGACGATGGCACCGCCCCCACCACTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTCACTGCGATACAGAAACGAAGCCCACGACCACAACTGCGGCAACATGTGCTACAAGTG
CCTGCTCCTGCAGGTCGAGGCGTCCACATACCATAGAAATGAATGGGCTCGCTCGACGTAAATATATAAAAGTTTGTATGGTCTTTAAATTCCCCATCCT
ATCGTTACTCTCGAACCTCTCTTTCTCTTCATGACATTTTCTTTTGTGGATACCTTAGAGTCCACAACACGGAATTGAGATAGTTGACAAGGGGAATGAG
CCCATCGTTTGTGGAAGAAAACAATAAACGAAAGGAAAGGACCAGTTAAACTCAAGTGCGCTTTCTCTTCCTGCGATTTTTTACGAGCCGCATGTAAAAG
AGCTTGTCGCTTCACAATTGTGCTACACACTGTCAAGCACTCGACAGACGACGCCCACGAATTCGCTCTTTGGCGTGCATAAGGTAGCGATGCCGAGAGA
TTCCGAAACAACACTAAACCCATGGATATAGTGACGGACTTGATGACCACAGCTATATGGGTCGCGTGACAATCGAAAGATGAGATTGAATTCTCCACGT
ATCATTCTCTCAATTATAGGGATTTGCCTTGGCTGTATAATTG