Description :
From Genome Similarity Track
Location :
contig_12:843374- 846124
Transcript NameFunction/comments
g3304.t1GPI ethanolamine phosphate transferase 3

Sequence
2750 bases(100 bases per row)
ATAAAGCTGCGGGAACCTCAGCACAACTTCCTCCGGGATGTCCTGGTCGAAGATGCCGATTACAATGATCGGGAGCGCCAAGAAGAAGTTCCAGCCCGCC
ATCACGAAGCTCTCGAAGAGCGGAGCACCCGACTGCCCATTGAAGAAGTTGAAGACGAAGAGACTGATGACGAGAGCGATGTTCTTGTAGAACGAGTAGC
GGATGACCTTGCAGACCCGCTTGTAGTTGCACCGCCCGTGAAGGAGGACGAGTCTCGTGAGGAAGCGGAATTGGCGACGGCGTAGTCGCTGGCGTTCACA
GCCTGAACACCTTCTTTGCCGCAAATGCCCACGCCGACGTGCGCTGTCTGGATCATGCTCACGTCGTTGGCGCCGTCTCCGATCGCCAGAGTGATCGGCT
GCTCTCCTTTTCCCTTCTGGCCACTGCCTTGACGACCTCCTTTGCGTACGAGCTGAACGATGTCTGCTTTCTGGGACGGACTCACCCGACAGGCAATAAG
CGCCTTGCAAACTCTGGCAACATTCAGTAGTTTCTCGGTCAGCACCTCGACGCGTTGCATGACTTCGGCAGACATTTTGAGTCGCGCGTCACGCGATGGG
AATATATGCACGAGCGCCTTGCCGTCGCAGACCATGGCCAGATTGTCGGCTACCTGGTCGCCTCGAATGAGTCGCTGTATCTCCGGAGATCCATGAAGGT
CGTCAAGCTGTGCACTCAACGCGTCGACGCGCTCGGCATTCACGTACAGCAGCTGCATTTTGTCGTTGATCAGCCGACAAGCGTGGCCGATGTTGATAGC
CGTCTCCTCCCGGTCTCCAGTGAGCACCCAGACCTTGATTCCAGCCTGCGCCAGGTCGAAAATGGCCGACGGCACTCCTTCCTGCAGCTTGTCCTCGATT
GCCGTCACTCCCAATAGCTGCATGTTCGTCTCGATCATCTCGGCGCTTGCATCCAGCTTCTCTTCGCGGTCTTCGAGTGCTGTCGAGGCTGCAATGTAAG
CTTCGTTGTACTCCTTGTATTCCTCCGCAGTAAGCACTCGTCGCCCAAGTACCAGCGTTCGCAGCCCTTCACGAGCGTAGTTCTTAAGGTGTCCAACCAG
TTTCGCGTGTGCGGCAGTATCGCCGTCACTCTTTCCTGGTGCAGCGCGTTCGAGCATCATGTTGTCGGCGCCCTTGCAGTACAAAACGTACTCGCGGGTC
TCTTCGTTCACCGCTACCACTGACATCCGCTTTCGCGTCGAGTTGAACTCGTTCACGTTAACGATCGTGTGGTATTTGGCAGTAGGATCGGGTGTCTGCT
GTGTGTCTGCAGTGTTAGGGGGGAGCAGAGACTGCTTTCGAGAGACCTCCACCTTCATGAGCGGTGCCGGCGCCACGAAGTTGTATCCCCAGGCACTTGG
CAGCCTTCACTAGAGCTTCCTCATCTGGTGATGACGCGCGGTAAGCAATTGCACCAGTCTTGGAATCTGTCTCGGGGATCACCGTGTGGCAAATCGACAA
GAGGGTGAGGAACTCGTGGATGAGTTCGCCTTGCTTGCCACCGGCGTACAGCGTTCGCAGCAGCCCTGGATCGTCGAAATGAATGCTGGGATCGAAGTGA
ACCTGGGCATCTTTCGGGTCACTGCCCTCATCGTTTAGCGCCACAGACTGCACGGGTGCTGCAGGTGATACCGTCTCGCGGATATCGTCGGTAGAGTCGA
TGTCGAGCCGCACTGCACTGCCAGCTCCGTCGGCGAGCGGGTTCACTTTTGCTTTCGCTGGAGATGGCGACTTGGCATTTGGTTTGGCACTGCCGCTAGC
GAGAGCAGCCACCGCTCGTCCGATCTCGGTCGTGCCGAAGCCGTACGAGATCCCACCGATCGAGCACTTGCGGAACTCCATGACGTTGCACGTCAACGTG
CCGGTCTTGTCGCTGAAGACGTACTCGACCTGGCCGAGCTCCTCGTTAAGCTCGGACGTCCGCGCCACTGCGTGTGTACCTTCGAAAACCATCTTGGCGT
CTGCCGTGATCCGGTTGGCTTGCAGCACCTTGATGATGTCGAGCGAGACGTAGAGCGAAATGGGCACGAGGTTGTTGTACAGGATGAGGAACGTGAAAAG
TTCACGACGAAGTCGCCGACGCCGTCCGCCTCTTTCATGAATGGCAAGTACCACACGCGACTGGCATTCGCCTTGCTCCAAAACGCCGCTACTATCGCGC
TTGCCAAGCAGAGCAGAAACATGGTGCTGAAGATCAACAGCATGCACCGATTCGCTGTTCTGTAGAGTTTGCTCTGCTTAGATGGCGCCGCTCGGGAGTT
TTGAAGCAGCTTGGTCTCACTACCTGTAAAGATCACGAGACCCACGACAAAAGCGCAGCTTCGAAGACTGCAGCCACGGAGTAACAGGTTCTCGGGGCCT
AGCGGTACTGCTGTTTCGCCTCGGTCGCTCTCACGCAGTAGCAGTCGACCGGTAAATGTGTAGAGCTGGTTGTTGGGCTGTTCATGCTCTACAGACCCGC
GCAGCCGTCGCACGGCTGAAGCACACACGGCTTCCTGCGACAGAGGACTTCCATGCAGCTCACGCCAGCCTACAGCCTGTGCCGTAGGCTTGACAGCTAT
TCGTCGCTTGAGATTTGTCTCGCCGTCCAGATTAGACGTCTCAATGAAGCACCGGCCTTCCTCCTCGGACGTGGCCAGAATCACCAGGTCTGCTGGTAAC
TCCTCGTGGTTCTCCACACACACGAGCTGTCCAACCTGTAAATCTTGCCA