Description :
From Genome Similarity Track
Location :
Scaffold_345:8433- 10450
Transcript NameFunction/comments
Phyta_totarag7350hypothetical protein

Sequence
2017 bases(100 bases per row)
aactcAACTTCAtggtgtttgtgctgtcCCTCAATAAACTTAATGGTGGCCGAATTAACCTGAGCTGTTGTGATACCAACACTTGGCTTCTATTAAGCTT
TTTGCTGGAAGATGACGTGGGGTatcggctgctgcagtcatTTTTCATTTTCAGGTGAGGTATAATGTGTTCATTTAGCATCTAGAGtctaagagcatct
ccactgGGCCTGCGCCAAACGCTATCTCTAAAGACGTTTTGGCGAGGCCTCCTAGTAATATTTCCGGTTTGGCGAGTTGTTCTCCCATCCGTAGCCTACC
AAAACTATCGCCAAACTGCCGATCTTCTCAAAAGTCAGTGAATTTCTCTCTACAAGACACTTGGCCTGCAGGATGAGTTGGCGGGCGCGCGTCGATGACC
TCCTTCTCTTAGCTCAAtacgagaacgacgacgaaacATCCGAGGCAATCGTGCAGGCCAATGCTTGTGCAGTGCTGACAGTAGCTGCAACGCAGCAGCC
CCGCAAGAAAAAGCACAAGGGTGGCTCCAGGCCTGGAAAGAGTGCCAACCTTAATCGTGGACAAGCTGCGGGGGATAATTGCTATACAACGACTACTTCG
CTCCCCGTCCAGTCTTCCCGGAAGCGTTGTTCAGACGGCGCTTCCGCATATCGGGGCAATTGTTTTGCCGCGTGGTGGAGAAAGTGACAGCGGCAGACAA
CTACCTCACACAGCGTCCAGATGCTTTGGGCGTCCTCGGTTTCTCTCCACGCCAGAAAGTCACGGTAGCTATGAGAATGCTTTGCTATGGCGTGTGTGCT
GATGAATTGGATGAGTAATGCCGGATTGCAGAAGCTACAGCATTAGAGAGCTTAAAGAGGTTCGCGAAGGCAGTGGTTGCGTGCTTCGGCGAGGAGTACT
TGCGTGACCCAACAGCCGCCGACATAGCGCAGCATGCTGGCATCAATGCTGCGTCTTTGACCTCATCTTCTAAGTTAGCGCCAGAACGCCGTGGCACCTT
GTCCTTCGCGCTGGCGAATCGCTTGGTATCGCTTGATATCTTCGACCATTTGCATTCTAGCGAGCGCTCGTCGCGCACCACCGAACCTTCAGACCTGGCT
CCGTTGAAATGCGCTGTGACCTTCTTCCACAGGTCACCGGAGGTTTGGTCCGTGCCTGTCTTCGCGTCCTTGCTAATCTTCAGATAGGAGATACACAGCT
GGGCATCCTCATCTCGAGAGAAACTAGCTCCGCGAGCCATGGCGGCGTGCGTTGGTCGTGTCGTGCGATCTTCTTGTGGCTTCTGGCCTTCGACGAGTGT
CTGAGAATGTCTGAGAATACTCTGATGCAATCTGGTTCCATATTTGGCAATTTCGCGCTAAGCTATCGCCAAACAGGGTCCGGTTTGACGAGTCCATGGC
GTTTGACGAGGCGTATCTTTCGCTATTTGGCAATATCGAGGTACCGGTGGGGGATAAATTACAACGCTTCTCGCCATTCGCATCTAAACGGGTGGATTTG
GCGTTTGGTGCGGTcccggtggagatgctctaacGAGCACTTAACCGCAGCCAACTCCCATACACGTCGTCAGCCGTTAGTATCAGTCTCTACTTACGGA
TGACCAGTCCCTCGCCGTTCCACCAGTCTAGGAATTCCTAGCTGCCATTCTGCTAAGTCTGTTGACGCATTTTGCAATGCGATATCCCATCTGCCTGCCG
GCATTTTGGTGCCTGCAGCGGTGAGTTGACGACTGCTCATGGAATCCATTGCGAGATTGGCTAAAGCGTCAGCAGTCTTGTTATATTCTCGGTAATGATG
GGTCCATGTGCGCACATCGCAAAAGTCGGCTAGTACTCTGCATTGTAAATACAGCCGCGTTAAGTGTCTCGCAATAGGAGGTCTCCTGTCACTATGAGTG
TCTTGCTGTCCCCAACCACATGTAATAGCCGAAACTGCGCACTCTTGGCGTGCTTTAGTCCACCTAGCAACCCGCGATATTCCGCTACATTGTTCCGTGA
TACGTTTATCTGGTAGA