Description :
From Genome Similarity Track
Location :
scaffold_12:84312- 96852
Transcript NameFunction/comments
g759.t1hypothetical protein
g760.t1hypothetical protein
g761.t1hypothetical protein
g762.t1 protein kinase, putative
g763.t1 hypothetical protein PHYSODRAFT_342844
g764.t1 aspartate aminotransferase, putative

Sequence
12540 bases(100 bases per row)
AGTATCACGGAAGAAGACCTTCGACGCAAGAGCGCGTGTATGCGCTGTCTTGTTGAACGAGTTGGACACGCTGCTGAAGATCAAGGTATCAAAAATTTCA
TTATTGATACCTTTCAGGAGGTATGGTTTGGCGCCGAGCTTTCGTCTTCTAGACTCACGAACCCGTTAAGCGAATTTGGCGATGGAAATACTCTACCACC
TGGTTGGGCGACTGCCACAATTACGGCCCACAGGAAGACTGATTCTGCTTTTGTAAACACGAAGTTTGTTTCAGAAGATGGGAATGTCGCCAACTCGATT
GAAGAAGCGTGGTCTTTATATCGAACTCCTGCGGTGACACCAGCCAGTGTTGTAAGGAAGCAAGACTCAACGCTCGACAACAGCTCAGAGATTGTTGCAA
CCATCGTTGAGGTCATTCATGAAGTACCAAAAATTGAATGGTTTACGGAGCTTCTCAAGAGACTATTGACTGAACGCAGTAACAACACGAGTAAAAGGAC
ATTGCAAGGCGTGAAACGTCGGTCATCCCAAGTTGAAATTGCTGAAGACCGCTCTGGAAAAATCGTTGATCGATTGGTGGAATGCCTCATGGACTTAAAA
GAGGACGCACTCCTGAAAGGGGTCTCGATAAAAGATAGACACCAGCAATTTGTTACTTGCTTGGTTGCGCTGGATGCCTTTTGCGAAGCAAAACCGCAGC
TTTTCGCTCATCATCTCGCGACGATACGAATATACCTAACGGAAACAGACCCAAAAGTCCAAAGCTTGTCGGTCTCTATGATCAACAACATTTTGCGCGT
TAAACGCGTTCCGCAGAGTGTCGCTATTGGGCTGGAAAACGATTTAAAACGTCTGGTACAACGATCCACCCCAAGCGTTGTTGGTCCGAGCATCCAGTGT
CTCGCAACCCTTTCAGCAGCACAGAACAGAGCGCCGATACTATTGTTCGAGTTGCTAGAATATTTTTTCCTCAGCATATCGAAGTTCAAACATAGAGCAT
CGCTTGCCGATTTGACGCATCAAGACAACAATGTACTCCAGCGTGCTTTGTTTGTAGCGGGGAAAATTGTTGGAGCCACAGACATCGACAATTTCCGGGA
ACTGGCTACGAAAGCGACAGTGACGAAGGTTGGAACGATTACAGAATCGCTCTACAGATTGTACGGGCAGTTCGTCCGAATGACAAGCAATGATGCATGC
GCTGCTAAAGCAGTACAAGGGATGGGATTTCTTTTTCCAATCAGGCCACGTTTGTTTCTCCAAGCACAGCAGGATGGTTTGTTAAACTTTCTTTTAACCG
CGAGTACTCGAAAAGCGAAGCTACAATGTCTCGTAAGCATGAAAGATCTGCTGGTATTTGAAGAAAAACGGCTGGAAAATGGGGTAGCCGCTCGGACGAT
GAATCAAGCAAAAAGCAAGGAGCAGCAAGTACGAGGTGACCAGGAAGCTGATGCTTCGTTGATTGGAAATGTCATGCAGGCGGAGTTGGGAAACATATTG
TTGTTATCGGTGCAGAAGGTGCCGCAAATCCGAAAGGAGGCCATCGCATGTATTGGTGCTTTGCTTACGCAAGGTTTGGTGAATCCATTGCAATGTATTC
CTAACTTGGTGGCACTGGAGACTGATCGAGTTCCGGACGTTCGAGACGCGGCATTCTCTCAAGTGCTTGGTCTATATGAGAAGTTTCGGAGTCAATTTCA
CGGACCAATGATTCAGGGTATTCGTGACTCGTACTCGTTCCAGCAGAACGTATATGGTAACGTTACATCACTGGCAGTTGACGAGAACCAAAACGATTTC
TGCCTATTTGGCCGGCTGTATACAAGTTGCGTCAAGTCGACACAATCGTACGCACCACGTTTTCTTTCGGCATTGGTGAATCAATTCACCGACCAGGGAA
GTGTGCTCAAGCCATTGAAGAGCAGACTTGCTACCGCTAACAACCATACCTTCTCGGCTACTTTGAAATATTTGTGCTATCTAGCGCAAATCATCTTAGC
GCTGCCTTTCGAACTGGAGGACGAACCCCTGTACGTTATTTATTTGATCAACCGCTACGTGAGCCTTCGACTTGGGTACGTATAGAATTGGTTGTGTATT
TGTTTTCTTAACCCCTCACAATTTTTAATCCACATTTTGTGTAGCCCTGTGCTGGATGCTCTCAAGGAAATATTTGCTAACGTGGGTGTATCGCCGGAAC
TGTTGGAAGACGATGAATCGGATCTATCAGAAGTGAAGATTGACGATTATAAGCTGCGGTCAGTGGCTGGTGCGAATTTGGTGACTTTGCAGAACAATGG
GGCTATTGCTTTTGCAATTGCACTGATGCTTCGCCTAAAGTTTGCGCTTAAGCGGAATTACCAGCTGGACAATGAAAAGTGCGCTACGTATAAGCCATCA
TCCGCAGATGATCTAGTCGAGGCAAAAGAACGCTCCTCTAAGAAACTACTGCTACCTTCCGTGGACGATTTGTGCCTATCCGAAGATCCAATCGAGCGCA
ACTGGAATCTGTTCATGACTGCATGGTCCGCGGCTCGCAAAGACCAAAAGCAGTTGGATGTCGATCTGGAGGAGGTGGTGAAAAGGCCGAAACCCACACC
AAAGCGACGACGGCGTTCGAGCAAAGCTAAGAAGCGAGAGGTCTTGGATAGCGACAGCGTCAACGAGGACGAAGACGTCGAAGGCTTCGCGTAATTGCCG
TTCGGCATAGTTTTGGTTGCATTTCACGAATTATTTTAGTTCTTTACCTTCGTCTGCCGTAGTCTTCTTCATGCGTACTCTTGAGCATATGCAGACTCAT
CCCGTCCGCTGTCAGCCGTCGCCGCTTCACATCTACGGTTCGCAGGAAAACCCCTTCAAACTCCGGAAGTGAAGGGTTATACAGCATATCCAGCGTCACC
AAGGGATCCACGAGCTCCAGACCGTCATGAAATAACTCCAACATCCTCGTCAAGCACCAGAACCGTTCCTCCTCTGGTGTCACCACTTCACACACAACTC
GAGCCATGCCTAAGAGGAAACTCGCGTCGTCCATTCCAAGCAGCACTGGAGCGTCGCAAGCTGCAATCTCTCGCCAATAAGTGCGATGTAAATGCACCAG
TCTCGTAAGTTCTTGAGGTGACGATGCCTTCTCTTCTCCGTCTTTCTCTTCTAAAAGCTCCATAAAGTCGTAGCACACCCCTCGACTTTCGTCGCCTCCC
GTAACATCTTTAACCTGAAGAACTTGTGCTGCACCCACAATATCCTCGAACATGGCGCGCCTCTCTTGCAGTGCAAAGCTCCATATGCCTGGATACGGCG
GCAGCACCCCCGCCAGCAATAACCAGATCTTGGCGCGATACTGCGGTGCAATGCCCAGCTCCAGCGCCAGTTTCAGCAGCTGTGACACGTTCACCGTTCG
CTCACTGAGTAGCGCCGCGAACGAGGCGTCCACATCCACAATATGCTGCACGACAGGCACGCCCAGCGTCTTGTAGTAGGTCGTGCGGAAGTTCCTACTC
AGCGCCATCGTTTGTCTTGGAAATCTCGGAAAAGGTAACCCAAATCTCGCCTTTTCACGTTTATGCGTTGTCGAAAGTTGGTACTTAAGCTAATTACTTG
TTGACCAACTTTCAAGCATGAGTACCATCCTTTGACTTTTTATTTGACTTTTTATTCCTCAACTTCAACTCTTTCCATATTTTTCTAGCGCTTCTTCGCG
AAGATCCACCTCACACATATATATATATATACATATATATATTCCAATCGTCTCGACAAAGAAGAACTCGAAGCGTCGATGGTCGCGTCGAGCCGCTCGC
TCAGCCCCAAGAAGCGCCAGTGGATCAGCCCCACCAGCAGCAAGGGCAACAGACGCCTCAAGCAGCACCCACGCCTGACTCAGTGTCGTGCCAGCGAAGG
ATCCGCAGGTGAAACGGACTGCGAGAGTCTGGACGACGTGGAAATGGAAGACGCCCCTTCTACGGAGCCCAAGACTACAGCTAGTGACATCCAGACACTG
CCGGACGAGCTGCTGGCGCTCGCACTTGCTCAACTAGACGGCCACTCGCTACTGGCGTGTGCTTCGACCTGCCGCGCCTTTAGAGCGTTGACATTCGACC
GGGAGGTGTGGAAGAGAATCTGCATTGGTAAATGGCCGAGTCTGAGGACACAAGTGCTGCCACAATTACCAGGAGCCCCGGACTATGATGTACGGGAGAT
ATGCTATTGTTTTTAAGAAGGATACGAGCTGTGGGGGAGATCTGGAGACTAACTATTGTTTTGTTACTTTTTGTGCAGTTGGTGAGACTCTACGGGGGCT
GTTGGAGACGCTGCTTCGTGGAGAAACATCCCAAGGAACAAAGAGCTGAGATCTCGGTTAAAGTGCCCAAGTTTTCCGACGTCGAAGCCATGAGAGACGT
GGAAAAAGTGGTGTCAAACACATTTACAATTGGTGCGCATCGCTTCTGTCTCTGGATATTTCCTAACGGCAACCCCAACGAGGCACAGTACAAAGGCCGT
GTGCTCAGTGTGTACCTCGTACTCACGGATTTATCCATACGTCCTCCGGACTGGCTCACGTGCGCAGTTTTCTCTCTGCAGGTTGAAAATGCTTTGGATC
CGAGACGTCGACTTGAGTGGCATTCCTGTCTTACGGACAACAAGTTCCACAAACATCTCAATAACTGGGGAGTTCATTCACTCGGTTCACTGGCTCTGCT
ACGTGACCCTCAGCAAGGGTTCCTGACGATTACGACTGAAGGTCAAACGCAGCCTGATACACTCACCATTTCAGCCCAAGTGCGACTGATGTCCATAACG
TTTCGTGTGGTGTTTGAGCACGATCTCAGAGAACACCATCAACTGGGACTCGTAGATTTCTCAAACGTCGCGGAACTGGAACTCCCTTTCTGCTGCTCAC
TGCTCGACTTATATGTCGCACTGCACGACCAGTTTTCCGAAGTGCTCGGAGAATACAGTGAAGCAGATGCAGCGATGAACAAGACGCGAGTGTGGTGCTT
TAACCAGCCGGTGGTGTCGGGTCAAGCGCTTCGACCACGCAAACTGCTCCAGTGTGAGAAATCTCTTCAAGATCGACCGCTCTTTGGACATTTACTCTGT
GACGGAGTGGACATTGACGCTTATTCGTTCTGCCAGATTTACGTTGAAAACAGCTCGGCAACGGAAAATCTCCCTTTGGATCTACCCTCTGGCAACACAA
CGACTGGGGATGAAGTATTGGCGACACCTGAAGGATACGTTTTCGTCAAACTACTGCAGCCAGCACCTGCCAATCGCTTAGAGTATGTGGGTAAAGTCCG
TGTCCTTGAAGCGTCATCACCGGAATTTGTGGATACGGAGAACAAACGTAAAAGGGAAAAGCTGGCACCTAGCGTACTGTATGAAGCTGTCGCACGCCGC
ACAGGTTGGAGCTGTGCGCAGCTGGAAATGTATCGAGAGGAGATTGCCCCCACTGTAGTCTCCGAGTTGATCCCGTACCACGCATCGGTTGAAAGTGCAG
GGTTGCAGTCAGCAGATATTGTGATATTCTGCGTTCGGCTGCAAAATTCTGACGAGCTTTCGGCAGTGAGTGGTTTAAACTTGTTGCACGATCTGCTTCT
GGAGCGCTATACTGAAGCTTGTGAACTCTTCAGTTCTCGTGCGCTAGCACAGCCCACACTAGAACAAGTTGAGAATTTGGCGGAGAAGCTGGATATCCCT
AAGTTCCGAGTGCGCAGTGCATTCCGCAAGTGTCATGAAGACGCACTTGCAACGCTGCGCTACATAATGGAAGGCCGTCACCTTGGCTTCATTTGTGACT
CGTGTGGAGAAACCGACTTTTCTGGAGCACGGTTTAACTGTGCCGTGTGCAGCGATTATGACTTGTGCGCTGCGTGCAATGGTAAGCGTCCGTAGTCTTT
CGGGGTTTGATACTGAACTAACGATAGTGTTTTTAAAAGCAGCGCAATCCTGCGAAACCTCACACCGCTATGCCAACGTCGACGGTAAGTGGCAGCGTGT
GTACAATTTCAAGGACCACAACACCCTGCACTCCATGCGCAAGATGCTGCCGGTATTTTATGGCAAACACCAGTGGCAGAAAGCAACTGACGGCTTACAG
TGCAATCACTGAGAGTGTTTCGAGGGTATGGGTGCTAATCTCATGTAATCTTTAGATTCATTCATTTTCTTACAACGTACTTCGCGTCTCCCAGCGAAAA
CTTGGCTCGGATCAGCTTCATACCTGTATCAAGTCTAAATTAGAAACAAAATAACATCGCATCTGCACTCAATGGCGCGGCCCACCTGCTTTCTCCTTGT
ACTGGACATGACGAGCGCACACGGCTTTCCTTGCGTTTTAGATGCAGCCAGTGTCGAAATCCGTGCTGTCGCGGGCAACGAGGCCGAATTCAGGATATTG
ATCGTCTGACTGGGACTCGCGCTCGATTCTAGTAACACCCAAGGCGCAACCCAAGACGCAAGAGAGAATCAGAGGGATCCCTACGATGACCCAGCAGACC
AGGTTCACGTCCATCGCTGCTTCAATGTCTTCCTCGTACGTACCCTTCGCTTACTCGTGGCTCCGATCTCCGTCCTGATCTGCGCTTCTCCCGTTTGCTG
CTTGACTCGCGCGACAACAACGCCGGCTCCTCAACCCTTGTGTACGAGAAGCCCTGGAACTCGTTCTTGGGCGACACGGCTAGACGCTTGTCCTGCTGCA
AGAAACCATGGTCAGGCAACTCCTTCGTAAACTCACGGTCGAAGTTCTGGATGTCCGTCGGGCTGCGCACACGCGGCTTGAAAGGCGGTTTGACGCCTCG
CTTCTCCAGCAACTTCCAGTCGATGGTGGCGAAGAACACGTGATTCTTGATATCCTCTACACCGGCACCAGGGCGCGAGCCGATCCGGTACGTTGGGTCG
CGTTCCAGCAAAGCTGAAATGAGACTCTTGACTTCAGAGCTCAGGCCAAAATGCGCAGGGAACTTCAGTGGCGACTTCATGATCTTGGTGCACATCTGCT
CGATGTTACGGTCGAAGAAAGGCGGCCAACCAGTGAGCATCTCGTACATGAGCGTACCGAGACTCCACCAGTCAATGGCCTTACCGTACTCCGTCTTCTT
CTTACGGCTGATGAGCATTTCAGGTGCCAAGTACTCCGGCGTGCCGCAAAAGGTCTTGGCGCCAGAAAAGTCCGTGCAGTCCGTTTTGGAGAGACCGAAG
TCGGTCAGTCGCACGTGGCCTGTCTCGTCTAGAAGAATGTTCTCCGGCTTAAGGTCCCTGTAGATGATATCCCGTTCGTGTAAGTGGCCAATGGCCGCCA
CCAGTTCAGCGGCGTAAAAGCGCACCATAGCCTCCGAGAAGGAGCGGAACTTCTTCAAGTGGAAGAAGATTTCGCCACCACAGCAGTAATCCGAGACCAT
CACGAGCTTGCTGGCCGTCTGGAACGAGTACTTGAGTCCGACAATGAACGGGTGGTCAATGGAGCTCATGATCTTGCGCTCCATCATGGTGTGTCCCACC
TGATTGCGCTTAACCAGCTCCGACTTTCGCAGCACTTTCATCGCGTAGATCTTGCCGTCCGTGCCTCGCTCTCTAGCCATGTAGACCTTTCCAAACGATC
CTTTTCCAAGCATTTTCAGGATCTCAAAGTCCTGCATGGTCACCATGTGCCCTGCAGCGTCCTCCGAAGCAAAGCTGTTGCTTCCACTGAGCCGCGAAGA
AGTGGCAAGCGCCGACGTCGACTGGACGTGCTTGGGTGCCGTCACCATGTCCACGCCGCGTGCTGCTCCATCCGTGCTGTTGCCGTCCTCCTCTTCACTC
TCGATGGAGCTGCTTCCAGTGTTCAGGAACTGCACGACCTCAACAGGTCGCGGTCGTAGCGTCAGCACTGCATTCATGTACGTCTCAATGGCCTCTCGAC
GCTGCTCAATGACACGTAGAGACAGTGACATGAAGAATTTCTTGGGGGGAAAGTAGAGTTTCCCCACTGTGGCGTATTTCCTCCTCAGCGTCTTGTGCAG
CTCTCGGAAGTGGCTATATCTCTTCTCCGACACTCGAATAGCCCCTGACTGGAAATGCACGTACACTTGGAACACCGTGTACCGCTTCTTACTTCCATTG
TCTCGATCTCGTCCAAGAACCAAAGCCCCCATGGAGCCTCCATGGCCTCCTCGTCCATCTTTCCCGTTCCACGTAGAAGATCGTCCAGCTCCACTGTTCA
CAGGAGAGTTGCCGGCGCTATCCGCCCCCGCAGGGATGTGCAGTCTGTCTGCTCTATCCGTCGTGAGTTTGGATTTCCAGCGGGGGATCTCCACCTTCAG
GATATCGTCTCCCGCAGGGGGTGCGGCCGGATACTCCGGGTGCAGCTGATGCTGCGGACTCAGATCTCTGCTTGTCGTGTGGATATTGTGGTAGTTGGAG
CTCCGATCAGGCGGCGACAGGACCGACCCGGAAGTATACGACGACGCGCTGGAACGTCCCGAGGCTGGTGCGTCCTGCAGGTGCGTGAGCGAGTGGCGCA
TCTGCGAGCTCTTCTTGCTGTTGCTGTGGCGCTTCTGGTGCGTCTGCGGGTCCTGGTACGACGCGCGCAGGTTAGTAGCAGAGTTGGCGCCCGGCCGGAC
CTGTACCTGGTGCTGGAACGTGGCGCTGATGTTGCGGCCGCTAGCGCTTCCGGCCGCGGAACGAGAGCGCGCCGGCGGGTCCATGGGCGGGCGGCGCGGG
TACTCGTCGACCGCGGGCATCGCTGGGGACGTCTTGGAGCTGGTCCCGGCTTTTGCGGTCGTCCGGTGGGTTTTGTAGAGTGAGTCTGCATAGGCTGTCT
CTAAAACGTTCAATTGCTCTATAAAGACATATTCAATCGAGCATCAGTTCTCGCAGGGACAATCGTTGGTTTGTGGACGACAATTGTAGGGGACCTACGG
AAATTGTCAATAAGGTTAAGGAGAGTGTAATTTCGCTCAACTATCACGTTTGCGCCGTTTCCTTATGCTTATACCCTGATCGTGCACTCTCTACATGCGC
GTCTTCGCCACGAAGTCAACGCTAGTACGTTCATGAACATGTCTTTCATCTTCGTGCCAAGTTTCGCCGCCAAGATCGCGCCTGTAGGTGATCTGACTGC
TACTTCTTGAGTTGCGTGGATCCACTCGATGGGGGAAATCTTATGTATGTTGATGAAGTGATATATTATCCAAAATGGCAGGTCGAAGAAAACGGATGGT
AACATTTCTACGGTGTATCCAAGGCGGACGAGTATTCTTCTGAGGGGCAGGCCTTGATTGCTGTCCAGGTCGCGGACGAGCTGCAATGGCCAGGACTTTG
TGCTGTGGTGTGCGTAGTGGACGACGCGCAGAAGGATACTGAGCCTTCCGTGCAAAGCGCTTGGTGCCGGAGCGGATGAAGTCTATGGATAGAGCGATTC
TAGCCAGGGATTTCGAACAGCTACTTTCGCGAGTGCTTATCGTTGCTACTGTCCGTGTTTGCAGATCCGCAACCGCGTCTACTTCGGCGAGTGTTACTGT
GAGCGGTTCAAGTACTAGTGTGAGTGATTCAAGTTGGTGCTGCCTCCAGCGTAGGGGAAGTCGGAGGAAGAGAAGGCAGGTACTTATACCCGGATTTGCG
CCTGTAAAAAGAGAGAGTTCATGCTGGTTCGAAGACGACGTTTAGCACCGCTGCGGTGGCTACTGGTAGTGCTGCGATAAGCAGTCTGTACGCGCACTAC
GCACTCAAGGGCAGCGCGAGCATGGAGTCGATGACCTTTTCGGCTGAAATCGACGCGGCTGCAGGAGATCCAGCGCGTCTGCACTGGCGCGGCTTCGGAC
GAGGCTGCGCTGGCGAAGCTGCTGCTGTCGAAGAGTGTGGAGCAGCGCTACCTGATCTTGTGGCGCTACCGCATCCCGTACAAGCAGAGCTTGACGGTGC
GGCATGTGGAAACAGAGTTTCCACGTAAGGAGAAGTACAGCGACGGCTTGGTGAAGGTATTAGGCGGCGAACAGAACGGGGAATAGAAGAAGGCGGTCCT
TCCCGGCTTGTGCTGTGACTCCATCGTACACCCAGGCAATGACTCCAGACCGAGCAGAAGATTGGGCGTCTGCTACCGCAATCCAAAGAACTACGTCCCC
GATGTGAAAAGAGCAGCTCGCTTTATCTCCGTCGCGCATGGTGCCGGGCATCGAGCCAATGCCGGACATTCGGGAACTATCGAATTGTCACTAGACAAGT
GCTACAGTAACGTTTAATAAAAGCACTCATTGCATTAAAGAAAGTAAAATGTCTCGTGTCCACTAGTTCAACAAGTACATGCTTTCACTCTCCTAGTTAC
GGGCACGCTTGTTCGACTGAGACGACGGGGTCGATGGGAAGAGAATCTGGTGCTGAGCTTGAGGCAGCGTCGCAGGAGCTGGAAGTTGAAGAGGCGGAAG
CTGAGCAGCGGAATAAGCGAGGTCAGAGGAAGTCCTGCTGCAGGATGCAGCTGGTTCAGTGGAGGGAGTAGTGTAGTGCGAGTCGGTAGTGGAGCTGGGG
CAGGGAGAACGAAATTCTGAAATTCTGCACCAGACTCGGGGTCATAATGCAGAAGCTGTCGTGGAGCCTGCTGATCGCCCAACGGAGCCTGCGGTTCTGT
TTGTGCCAGTACATGTGCTGCTGCATGAACAGGAGCTTGGTGTTGCTCACCCTGAGCTAGAAGTCCTTGGCTGAGAATCGGGTTCTCGATACTCAAGAGG
TGGTCTCTGGTTTTTCTCACTGTTGGTACTGGGTAGACGAACCGTAGCGCGCAAATGACGTCGTGAATGAGCGGCAGAGTTTTTTTATTGAACGCAAAGT
GCTCGTAGGATCGGCCTTGATAGTCGGAAACCGTAATTCGCGAAAAGCCAAGCATTGTCAATTTGGACTTCAACAGAATCTCGGCCTCTTTGTATTCTTC
TTGAGTGAGTTCCAAGACTTCACAGGCCCACCCTTTGCCACTAAAGGTCCAGTCGGTGCACGTAAACTCCGCACGTTCTAGCAGGAGGTAGCTCGTAACA
CACGCCAGCAACGAAAGGACCATGATGAACCGCGTATTCTCTGTTTGGAGTTGTCGTCAATTCCTTCCTGAAAACTTTACTGAACCAAACCCCCGATAAG
TTCTGCAAACACTTGAACATGCGCTCATCCATTAGCGCATGCTCAAGTCGCAGGAATATCTTGTCATTCGGCCCACGGCGAAACCCCGACGACGTCGAAA
GCGTCCTGGCTCCAGCCTCGTCCACATTCAAATATTCGTCAAGGAAATGTGTCGAGATCACGTCTGCCAAACTTCGTGAACCACTAAAAATCTTCTTTTG
CAATGCTTTCCAGGGGATAAACGTCATGCCTTCAAAGAATTGCAGCTCTGGAAACATTTGCTCGTACTGACGTAGAGTGCTGCATCCGATCCTGGAGTTT
TGTTGAGGTCGAGAGGCGCACCCATTGAACGTCTGCCGACGATCGAAGTCTGCCATAATCCAGCACGGCAACGCCGTCACCGCGTTACTCGATCCGGACT
GTTGGCGCTGGAGTGAAAGGAAGAGTAAGGACTGCCAACTACCTGCCATGGTCTACATCATCAGGGGGCTGCTGCACCTACTGCATGGTGATCATCAGCG
GGAGCTAAGAACAGGCTGGTCATTTTTCAAGCCGATCATGCCGGGTTCCTCTAAGAGAAAACTCCAACTGCTTTACAGTTAGGCAATGCTTGCTCCTGAA
CGGCGCCGCAGGTGCAAACCGATGCAAACCGCCAGTATATTCTCACGGTGAACACGATCTCAGTGCGTTGGGAGCGTGATCTTCTTCATGTTTGACTTGA
GCCTTGACGGCGTAAAAATTCCGGCTCCGTTCGTGCATCGAAGGCAGTTAACACAACGACGCGCACCGGTTTCTCAACCGACCAAGCTTAGAAGCCGACG
CCGGGGTTGCTGGCCGTTGCTGGCGCGGCAGACGGCCGAGCAAGAGCCATCCACGCCGTCAACTTGCGCATAGCGATGTCAAGATTCGGGCAGACCGACT
GAATGAAGCCTTCGATTGCCTCCAGAGACGGGTCGTCTTGCTGCGAAAAACAAAGGCACAAGAAGCGGGGAGTCAGCGTTTCGGTGGCACAACGGCACTT
GCTTGCTGGAGGAAAAGGCCTTCTTACCATGCTCTCGATGAGGTAGAGCGCGAGGTCTCCCTTGAAGTCGACAAACGCCAGCCGCGCGAAGAGCTCTTCT
GGCGCACGACCGAAAGCCGAGCCCGGCAAGATTGCCACGCCCGTATCCTGCAACAGATGTGCGCACAGCTGCTCATCAGTCGAAACGCCTCTCAATGCGA
GGGCCTTGCGGTGTCGACGGAAGCACGGGAACAGATAGAAGCCGGCCTCCGGGACCTGGACCTCGACATCCATCTTCTGTAGCTGATAGGCGAACCAGCC
ACCGATAAGTTGCAGCGTTTTCTGGCACTTGCGCTTGTACGACGCGAGCTCGACGCAACTACAGAGAGCAGAGAGCAAAATTTACAGGAAGGTGAGACGT
TGGAGCGATGTATCGAGGTTGGTTGACTGCTTGCGAGGAT