Description :
From Genome Similarity Track
Location :
Scaffold_1352:843- 4845
Sequence
4002 bases(100 bases per row)
TTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCATCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAACTCG
TTGACAGCCTTGAGTCTCGACACATGCACTACTGTGTAGAAGCGATACCCACTTCAGTCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCT
TGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCAGCTCCCAATCTCAAAAAG
AGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCATTTCCACTTGGTTGAGGTACAGCGGCTTTT
TCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCTCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGTCATAGTGAGGGCAACCTCATGTTGTCGAT
TGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCACCCCAACCATG
AACGAGGTAGAACGGTGTTTCCTTCCTTGTAGTGTCCTGAGAAGTATTAATAGCAAACACCAGCTTCTCTGCAATTTCATCCCAATCTTGCTGTAGAGGG
TCTTCAGCGTACACCCGTACGGAACCCCTCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCCCGTGATCTTG
ACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACA
TTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTAACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGCG
TTGCCCCTGCGAGATTTCGGTAGTAGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTGGCCGGGTGAGTATCCATGAAGCT
GCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTTTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAATGCGATG
GAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACTACAAGCCATAGCTTG
GTCTCTTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCGTACTTCCAGGCAT
CTCGAGCTTCTTTGTAGCTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCTGTATCCGTCT
GCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCGTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATGTTCGCCGAAT
GAAGCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTCTTCATCTGCAAACCTGACGCGTTTCTTGGCTA
TCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTGAAGATTCG
CTGCCTGACAGTACATGTACTTGACGCTCTGTTCCACGTGACGAAACATCTACCGAGTCTTCATCCGGTTCGTAGATCATTTCCTGGATACGATTCAGCG
ACGCCAGTTCCGACTTGCGAGTTTCAGCCAATATGGCACGACTGACCTTCGATTCCAGCGCTTCAGCGGCTAATGAATCCGCGGCAGCGTTGTATTCTCG
TACAATGTAAAGATATTTCACTGATTGAAGCTTAGCCGCGAGCTCCTTGTAAGTATTTAGCACTAGCAGAGTTTCCTTCCTGCATGCGATCTCCCCTAGT
GATTGTTGAATAGCGAGCCTTGAGTCACCAACGATCTCTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTCACACCGTTCTACATCCCTGTGGACTCTG
CCTCATTTACCGTGGTGGCCGAGAGGTAAACGTTTGCAGCAAATCACTATCTTCCACTTAGGAAGGCTCCACAACACCCAGGAGCAGCTCCCGTAGCCAC
CGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCTACTGTAAATATGAGGAATCCTGGCGTACAGCAACGCGGGGTCCATCGAACAGTC
GGAGATCCCTTGTTTGGAGGTGCCACCGGCGCGAGTGAATCTTCCAAGTCGACGAAGCTCGTAATGCTTGACTGCAGTAGCTGTGCGAAGGCGACATCCT
TCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACGGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAA
CGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTTTCAGCAGGA
TGGTAGTTCATCTCGGCCTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATT
CATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTAAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACG
TGCCGCAGAAAGGCCACCTTTCAACGGCAAAGTCTTCATCCATGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTTGAATGAAGCGGCTGTAGT
AATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGCAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCCCTGATACATTC
TGGCGAAATTTTATGCGACAGAAAGTTCACCTTGGGCTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAAT
CGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAACACAGGTACCAGCGATGATTCGT
CCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGCACAGGGTCGGCCTCCACCGGTGCTTTGCGGTCTGCCGCGAACTTCGT
TTGAAACGAACCCTCGGTGCTTGGCCCACGACGTTTCTTGGCCTGTTCTTCAGCCTAACACATCGTCTCCAAGTATTCAAACCAACCTCCTTTAGGCTGA
ACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCCTTAATCCAAAGGGCATGCGTAACCACTCAAAATGTCCAAGTGCGC
AGACGAAACGCCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGA
TCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGT
TCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCC
GAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCTTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCG
TT