Description :
From Genome Similarity Track
Location :
Scaffold_497:843- 2775
Transcript NameFunction/comments
Phyra_49780conserved unknown protein

Sequence
1932 bases(100 bases per row)
CACTAGGTCATTTCAAAGCCGGCGCCGGAAGAGATGGAGGTGAGCAGCTTGGCGCGAAGCACCTTGTACGACGAGTATGTGGGCAGCTTGAGCGTGTTGA
AACACGTGGAGGAGCTGGGCAGCAACTCGTCGTCGCTTCGGATGGGAATCTTCTGCACGCAGAACTGGGGCGTGAGCGACCCGAAGCCCAGCGACGGAGC
GCGTTGGCAACTCGTGGCGAAGCGCAAAAACGCAGCCTGCTCGGAGGGCGTGAAGCTCGCCAGCGCCTGCCACAGCCACGCGACGCGTTTATCCAACGCG
TAGTAGCCGCCAGCGTAGCGTGCGTTGGCCTTGAGATCATCGACATCGATCTTGCCGCTTTTGCCTGAAATCAGCACTTGCAACTCTGGCTCATTGAACA
TCTGGAGCCACCGCGGGTGGATGAGGTCTGACAAGCCCATCCGGAAAGCTGCGCATTGTTCGCGGATCTGCGTGTTGAGGTAGTAATTCGCAACCAGGTG
GATATACCGCGTCTTGTTTCGGCTCGTCACGGGCACATTGCCTCCTCCCGGGATGATTTCGATCTCTTTCTGCTCTCCAAAGACGTCTTGAACAACCGTG
TGCGTGAGGCCAAGGTCCTCCACGTCGCCGTCGTAAGACTTGAGGAACATTAAATTCTGCATCACAAAGAACTCGCAGCATGGTAGAGCGTCAGCAAAAA
CGTTCGGCATATCGCGTCTCAAAAGCGCGTACCTTGTAAATCTCGGGGTCCAATGACGGCAACTCGTTCAGTTGGTTGAACGAATGCAAAAGCTTGGAAA
GAAAGAAGTGGGCAAATTTTGGCTGCACCACAATGCCTTCATACAACGCCTTTCCCAAAATTCGGACGACGAACTGGAACATCGTCAGGTGATCACTCTC
TCGTGAGAAATGGTCTGAGGCCGAGTTTGGGTTCGGATACAAGAGCTGGTCTTGGGTCGTGAGAAAGAGTCCATACTGCAGATCAAATGCGAGTGTCGAC
AGGTCCAACCAAAACTCTTTGAAGAGTCCTCCAGCATCAATGCCCACTTCCTCGCGCCCAGCGGAGTTCACGAACACCACGTTGATTCGCTTCTTGAGGT
TTGTACGAATCGAATTGAGCTTCTTCAGGCCGTCTTCCAGAATGGCACCTCTGTGAATGCGAATGCGGTATACTGAGCAGCTTTCGTTTTGGTGAACGTC
TTTGTCAGCCTTGACAAGCCGCTGGAACAATTTGACGCGGTCAGGAAACGGCACCAAATATGGCATCGACTGGATCAACTTGTTCGCACGTGGTGTGCCC
AGCAACACTTCTTCAATCAATTGGTTGCTATCCAACTCAGTAATGATCCTGCAATATCAAAATCCATCCAGTATTAGTCATCATCCGATAACTATCAACA
ACATTAATAACACACCAGCTCGTGACGTTGCAAAAAGGCTGACGAGAGCACCGGTTGTACAGAACCCTCATCAACCGAGTTCCCGTCTCAACGACAAACA
TGCCAAATGCCACCGATTCAGAAGATGGGGCAAGGTTCGCGAACGTCCAATACGCTTCATGAAGAGCATGCTTCAGGCTCAACACAATCCGCTCAACCTG
GCAGATAGGAAGAGGGTACTCCTGCTCGTACATCTACAAAGGCGAATCGATGAATAATCGGCATATAGGTAGCGGTGACAGCTCAATCGAACAATGGACA
CGTACCTCTTCATCGTCCATCACGACCAGGAGATGCTCGTACGTCATACAAAACAGCACTAGCATGCACACGTACGGATCGGAGCTCCGCGCGTGAATTA
AATCCACATTCTGTCGCGCATCTCAAGGTTAGTTTGTTGGAGACAGAACATACACTACTGAAAGAAGCCGTACCTTCGCGAAATCTTCAAAATCCTTGGT
GTCTTGTAATACACACCACAACATATTGACCA