Description :
From Genome Similarity Track
Location :
contig_68:8427- 10472
Transcript NameFunction/comments
g9621.t1hypothetical protein

Sequence
2045 bases(100 bases per row)
ATGGATCGCAGTGACTCCCAGGAATCCTCTTCGTCTTGAAGGCCGACCCAAGATACAAACAGCTGCCAATCACCATGTTCGTTGCGATGCTGTTTGATAG
CTTCCACTCCAAGAAGCATACCCTGATTGCCGATGTGAGCGAGCATCTCCTCGTTCACGTTGAGCATGCTGTCGCTGTAAAACTTCAAACGCGAGCCATG
GACATCGAATGTCTGGTCTGTCACCAAGTGTCGGATGACAAACGAGTGCGGGCGGGTTTCCACTACCTCAAAGGGTCCGACCCATTGGCGAGCAGCTTGT
CCACTGTTAGCCTCTGGTCGATCCTCGACCAGAGCACGAAATCACCAACTGCGAAGTTGCACGGCGATCCCTTCGATTGTTGCATGTTCTGAAGTCGGCG
TTTTTCACGGAGGTCAACAACCTCCCGGTGCATTGCCGCGAGATCGGAACGAAGACGTTCCATACGACACAGGTAGCGCGATGTCCTCCGTAAGCACCAC
CGGTTTGCCATTCATCTCAATGATGACAGGCTCGAAAGGAGATGGTCGTCGTAGACCAGTAAACGTCTCCACAGGCGACCGATTGCCACTGGTGTGTGGT
TCAGATTACCTTGCACCAACGGGAGCAGGTACACCCACTCATGGGTGTCCAGCTTGAGCTCCATCAAGAGAACCCTCATCACCTGTAGAATGTCACGGTT
GACCGTTCAACCGTGCCATTAATCCAGGGCGAGTAGGCCACCACAAGCTCTTGTCGTAGTTGCAGCTTCTTGCACACTTGCTGTACTACAGCGTTTTTAA
AGTGGCTTCCTTGGTCCGAGATCAGGACCGAAGGAGCTCCGAATCTCTTCCACCAGTCCATTAGAGCTGTTGCTGCCACGATGCTCGAGGCAGTATCACA
CGCTATCAACTCGCAGTAGTGCGAGAGTCCATCCTTCAACACCAGGACGTACTTGCTAGCACCTGCGCTTTCACCCATGAACAGGAAATCCCAGTGCAAT
AGTTCGTTCGGCTCCGTAGCGTCGTAAGTTGGGCCCCACGGCCGAGTGATGATGTTGCCGCCTTTCACATGTTTGCAAAGCAAGCAACGGCTGAGGAAAC
GACGACACAGTGCGGACAGCCCACTGATAGAAAATACCGACTCAATTGTCGATACCATGGGCTCCAAACCACGGTGGCCTTGCAAGCCGCAATGGCTTAT
CACGAAAATTCGTTGCAGTAATTCCGTTGCTACGGCGGGAACCCAAAGGCGATCATTCACCAGCACGAGGCCACTGTCATCGCGTCCCACCTCCAACGGT
GCGCTGCTTGCATGTTCTTCTTGTGCAGCACGAATAGACCCCAACGACGGAAACTCGAAGTCGTCAGATATCATGTGCAGCCGCTGTACTTGATCTACAG
GTTCGGCGTGGTTCGGGTCCACTAGCACCTCCGAGTGCTCTGGGAGCTCATGTCCACGATGAACTTGATCCACACGGTGAGTGTGATCCTGGTCCACTCG
CACCTCTGGTTCCACACAGATTCAGACTCCTCCGCGTCAGCAGCTTCTGCGAGCTCGCGAGCGCGGCTTCGTGTTATAAACTTGCATTGCATACTGACCC
CCCCTCCTCAACCGGAAGCCCCCACCGAGAAAGCAAATCTGCCCACAGATTATCGGTGCCGTCAATGTGTTCAACTTGAAACGCAAGACCAGTGAGAGAA
AGCGCCCAGCGCTGTAGCTTGCCGCGAACATGGCGTTTCACTTCCTTGTCTGGAGCGAAAACGAACACGAGGTTCTTATGATCGCAATAGAGACGGAATC
CACCTCGACGAACAAGCAGGTATCCCAGGTTACGCGCAGCGAAAATGATCGGGAATGCCTCCTTCTCAATGATACTCCAGCGCTGCTCTGTGTCGCTAAA
GACACCGCTCTTACACAGCAGAAGCTCATGCTGCTGCTCCACAACAGGCAATGCATCATTCCACTCGCGGACCTGTGAGACCAGTAGCCCCCAACCACGT
TCAGACGCATCGCTGAAAACACACAGGCTGGCAGAGTCGTCAGGG