Description :
From Genome Similarity Track
Location :
Scaffold_369:8427- 10267
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_369-abinit-gene-0.45Heat shock 70 kDa protein
Pytiw_DAOMBR242034maker-piw_contig_369-snap-gene-0.8NAD-specific glutamate dehydrogenase

Sequence
1840 bases(100 bases per row)
GTGGCGCCGCCCATGTCGGTCGCATACATCTTCTGCAGAATGGGACTGGCCACACTCTCGAGCTCCTTCTGCTTGGCGTCGAACTCGTCCTTCTCGGCCG
CCTGGTTGGCGTCCAGCCACGCGATCGTCTCGGCGATCTTGTCCTCGAGCGTCTTCTTGTCATCCGCGGCCAGCTTGGCCTGCAGCTTCTCCTCCTGAAG
CGAGTTGCGCAGCCCGTAGGCGTAGTTCTCGAGCGCGTTCTTGGCCTCGACGCGCAGCTTGTTGCGCTCGTCGGCGTCCTTGTAGCGCTCGGCCTCCTCG
ACCATGCGGTCAATGTCTGCCTGCGAGAGGCGACCCTTGTCATTCGTAATCGTGATCTTGTTCTCCTTGCCTGTGGACTTCTCCACGGCCGACACGTTCA
AGATCCCGTTCGCGTCAATGTCAAAGGTCACGTCGATCTGCGGCACGCCACGCGGCATGGGCGGGATGCCGTCGAGGCTGAACTTGCCCAGCGAGTGATT
GTCGCGCGTCATTGTGCGCTCGCCCTCGAAGACCTGGATGAGCACACCCGGTTGGTTGTCCGCGTACGTCGAGAACGTCTGCGACTTCTTCGTGGGCACG
GTCGTGTTGCGCGGGATGAGCGTTGTCATGACGCCGCCGGCCGTCTCGAGTCCCATGGACAGCGGCGCCACATCCAACAGCAGCAGGTCCTGCAGCCGAC
TCGACTTATCATTACCACTGAGGATCGCGGCCTGGACCGTGGCGCCAAAGGCCACCGCCTCGTCCGGGTTGATCGACTTGTACAGGTCCTTGCCGTTGAA
GAACTCCGAGAGCATTTGCTGGACCTTGGGGATGCGCGTCGAGCCGCCGACCAGCACGATCTCGTTCACCTGGCGCTTGGAGAGCTTGGCGTCACGCAGC
ACGCGCTCCACGGGCTCCATGGTCTTGCGGAAGTAGTCGGCGCACAGGTCCTCGAAGCGCGCACGCGTGATTGTCGAGTTGAAGTCGATGCCGTCGAACA
GCGAGTCGATCTCAATGTACGCCTGGGCCGAGGACGAGAGCGTGCGTTTGGCGCGCTCGCAAGCCGTACGCAGACGACGCAGCGCGCGCTGGTTGCTCGT
CATGTCCTTGCGATGCTTGCGCTTGAACTCGGCTGTGAAGAACTCGACGAGGCGGTTGTCAAAGTCCTCGCCGCCCAGGTGCGTGTCGCCCGCCGTGGCC
TTGACCTCGAAGATGCCCTCTTCGATGGTGAGCAACGAGACGTCGAACGTGCCGCCGCCCAGGTCGAAGATGAGCACGTTGTGCTCGCCGCCCTTCTTGT
CCAGGCCGTAGGCGATGGCCGCGGCCGTGGGTTCGTTGATAATGCGCAGTACGTTGAGCCCCGAGATGGCGCCGGCGTCCTTGGTCGCCTGGCGCTGCGA
GTCGTTGAAGTACGCTGGCACTGTGATCACGGCGTTCTTGACCTCCTTGCCAATGAAGGCCTCCGACACTTCGCGCATCTTGATGAGCACCATGGACGAA
ATCTCCTCGGGCTGGAACGTCTTGGTCTCGCCCTTGAAGTGCACGACGATCTGCGGCTTGTTGTCCGCGCCCGCCACGACCTTGAAGGGCCAGTGCTTGA
GGTCCGCCTGCACGACTTGGTCCGAGAACTTGCGGCCAATGAGTCGCTTGGCGTCGAAGACCGTGTTGGCTGGGTTCATGGCCACCTGGTTCTTGGCGGC
GTCGCCGATAAGTCGCTCCGTGTCCGTGAAGGCCACGTACGACGGCGTCGTGCGGTTTCCCTGGTCGTTCGCGATGATTTCGACACGGTCGTTCTGCCAC
ACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGA