Description :
From Genome Similarity Track
Location :
Scaffold_926:8425- 9892
Transcript NameFunction/comments
Phypl_g11679hypothetical protein PHYSODRAFT_485789

Sequence
1467 bases(100 bases per row)
GCCCGAGATCCCGGCCGAAGCCGCTGTCACGCTGTTGCCGGCGACTCCGCTGATGGAAGTGCTGAGCCACCCCAACGAGTTTGTCGCCCTTgacgctgct
tctccgaagcctgccgctgctgctccgaagcctgtcgctgccgctccaACGGTTTACTCCCATGCCAACCGTCTGCTCACCCGCAGCGCGTCTGCCGCTG
GAGACGTAGCCCCGCTGACGTTACACTCGTTTCGCCGCGGCGGTGCACAGCACGCGAACAGGTGCGAATGCCTCACACACCGCTGGATCTTTGACCGTGG
GGCCTGGAACATGTCGACAACAAACAAGGGGTTACTGCATCTTCAACACAAGCAGAGAAGATCACATGGTCAGTAAAGCACTCAGCGGGTACGTCACGTA
GGCCGCAGTCAAGGCGCTTGACTTGAAGCCGTTCGACGCGGagacgcagaagaagatcgccgGTGTCCAATGCTCGCTTTTCACAACCTGCTACAAGATG
GAAAGCCCCAAGTGCAACCTNGAGCTTCTTGCATGGTCTTCACATCTCGCGACCTGTGGAAGCACCAAGCCAAGCcgagaacaagctgcagatACGTACA
AGGAACAAAGCAACAAGAGTAAGATCATCGACCATCAACGCAGTGTCATTGACCAGTTAATGGCACACACCAAGCGCCAAGACGAGCGCTTAGACAACCT
AGAAGCTAAAATGGACGGAGCCCCAGCACAAGGCAAGAGTAACAAGCGTCAGCAGGATCCAAGCCAAGAGCAAGACAAACCCAAACGCCGACGGACGTCG
GTGACTTACATTCACGCGACGTGATTCGCGTGGTACGCGCAGGAACCTCGCTGGATGGCAGACGTGCcgaagcggcagcggtcaaacacgaagcagctcg
tgggcTTGATGAAGCCCTTCGTCGCCGACGACTTGAAGCTGGACCCAAGCACTGACGACTATCGTGACCAAGTCCTGGCGCTCgggaagaaggaggaggc
tgtCGTACTAGCCTTCCTCAACGCCCGCAAGATCACGTCGGGCGGCTCCACAGCTATCCGCAAGCACCTTCACGAGTTGTACGTGAAGGGTGACCTAAAC
GACAAGATCGCCtggcacctgcagctgcgtcgtGCTGATGCCATCCATGACCCAGACCGCCAAGACACCCTGGAGCATGTGGCATCTACCATCTAGAATG
GAACGACAAAGATAAAAGCAAGCACAGAAGCATAGGAGGCAAATACAATGTCTACTGCATGTTTAGCACGACTCACAGTAGGCTAGAAGCAACAGTAGAT
ACATCACACATCGCACAGCAACACAGTACCGACATCAAACGCAGTGGCGACAGCACACGCAAAGCCCCACCCCGAAGCAAAGTTTGGCGACGGCTGGAGT
TGAACCAGCATCCTCGGAGCCAAGCTCCACGCTCATCCGCTGAGCTGCGTCGTGGTGTTGGGGCGGG