Description :
From Genome Similarity Track
Location :
Scaffold_30:84231- 85697
Sequence
1466 bases(100 bases per row)
CTTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATACCCACGCCAATACACCAGAAATACACGGTAAACCCGTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACGCGGTCGGATACATCCACT
GAAAGACGGATCTGTGACCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCA
GCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTTGATCCAAATA
AAGCCACACCTGTGATCCCACTTGGATTTGATGTGGACAGACATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCTCC
TGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATTGCCGCTTCCA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTA
CTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGAACGA
TATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGACTCGGTTGAATGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCTAATCATCTCGC
TAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAA
GTCCACCCAAATCAACAATTTTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATA
TTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCATAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCC
AGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGT
TTCTGGTATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATA