Description :
From Genome Similarity Track
Location :
Scaffold_1019:8422- 9812
Transcript NameFunction/comments
Phypl_g12085hypothetical protein

Sequence
1390 bases(100 bases per row)
AACCCgcgcgaggccgacgacATGACGTCGCTCTACTACATCCACGAGGCGGGAGTGCTGCACAACCTGGAGGAGCGCTGCaagctcgacggcggcgacg
gcaccgGCCAGAAGCCCTACACGTTCATGGCCAACGTGCTGATCGCCGTCAACCCGCTGCGCGACCTGCCCAACCCGCGCATCAGCGAGGTGGTGAACAC
cgccggcagctcgcccCACCCGTACTCCATCGCCGAGATGGCCTACCAGCAGATGGTCTACAACTCGGGCACGGACCAGCCGACCAACCAGTCGGTCGTC
ATCAGCGGTGAAAGCGGCGCCGGTAAGACGGAGTCGTCCAAGatcgtgctgcgccacctgaCCACGCGCGGCCTGTACGGCAAGAAGGCCCGCGGAGACG
AGATCGAGAGCATGTCCAAGacccggcagcagcacggcacGTCGCTGGACCACCGCCTTATTGAGCAGAACCCCATCCTGGAAGCGTTCGGcaacgccaa
gacgctgcgcaacTACAACTCGTCGCGTTTCGGCAAgttcatgaagctgcagttcACGGCGGACGGCGAGTTCAAGCTGGCCGGTGCTTTCGTGGAGACG
TATCTGCTGGAAAAGTCGCGACTCGTGTACCaggtggacggcgagcgcaACTTCCACATCTTTTACCAGCTGTTGGCCGGTGCCTCGTCCGCCGCCCGCC
AGGAGTTCGATCTGACGAAGGCCGAGGACTTCTGCTACCTGAACCAGAGCGGATGCTACATTGCCGAGGAAACGGACGACCACGCGTGCTTTGAGGCTGT
GGTGCGCGGTCTGAGCTGCGTGGGGATCGACgagcaggtccagcacgtGATCTTTTCGGTGATCGCGggtcttctccacctcggTAACATTGagttcgac
gaagaagataCGCCCGAGGGCGAAGCCGCTGTCATCGAAAAGGAGTCTGCTAAGCGCGCTATTGTCGTCGCAGCTAAACTGCTGGGcgtcaaggagaagg
acctGTGGAAGGTGATCATGACGCGCGACATTGTGACGCGTGAGGAGACGTACACCGTTCGCCGTAACGAGCAGGCTGCTGTGTACGCTCGTGACGCCAT
TGCGAAGGCCCTCTACAGCCGCATGTTCGACTGGGTTATCAAGCAGGTGAACTCGTCTCTGGGTCACGATCCCAACCCGCTGCCGTACATTGGTGTGCTC
GATATCTTCGGTTTCGAGTCGTTCCAGCGCAATGACTTCGAGCAGCTACTGATCAACTACACGAACGAAGTACTGCAGGCGACATTCAACAACCAGGTGT
TCATTGCCGAAATGGAGCTTTACAAGCGTGAAGGCATTACGGTGGGCAGAATTAAGTGGCCTGACAACCGCGAGTGTGTGGATCTGATTG