Description :
From Genome Similarity Track
Location :
Scaffold_235:8420- 14583
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.8NUC156 family protein
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.1Collagen alpha chain

Sequence
6163 bases(100 bases per row)
GCAGTGTTCACGTGGGGCGCCGGCTCGCTCGGGCAGCTCGGCCACGGCGAGTTCGTCAAGTCTGGGCTGCGCAACTCGTACGAGGAGCTGACGCCGCGGC
TCGTCGAGGCCTTCGAGGGCAAGGCGATCGCGCAGCTCGAGTTCGGTGCCACGCACAGCGCCGCCAGTACGTGGCCGTCATTGGAGTGTTGCCTGCTGAT
CCGACAGCGTCTAACGCGCGTGCAGTCGACACGCAGGGCCAGCTGTACATGTGGGGCTCGAATGAGTACAACAAGCTCGGGCTCGGGCCTGGCACCGCCG
ACGTGGAGCCGCTGCCGCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGCATCCGCATCGTGGACGTGTCGTGCGCCGACTACTACA
CGTGCGCGGTGGACAGCGAGGGCAAGATCTATTCGTGGGGCTGGGGCGGGTCCACCATGAAAGGCGCGGGCGGCCTTGGCCACGCGGGCGGCCAGGACGA
GCCGACGCCGCGGCTGCTGCGGACACTGACAGACCAGGGCGTGCCGATCGAAGCCGTCGAGTGCGGCGAGTTCCACACGGTCGCGCTCACGACCGACGGC
GAGGTGTGGGCGTGGGGCAACGGCGAGTACGGTCGCCTGGGCAACGGCGAGACGGACACGCTGGAGGTGCCCGAGCCGGTCGAGTTCTTTGCGGACGACG
AAGTCGTGGCCATTGCTGCTGGCCGCGACTTTTCCTTCGCGCTCACCGACAGCGGCGAGCTCTACGGCTGGGGCGGAAACAGCCGTGCGTATCGAACCTT
GCGATGTGACGAGTCAATGGCAGGAGCTCTAACTCTCTTGCTGCTCCTGTCTGTCCAGAGAACCAGCTTGGCGTCGGCGGCGGTCTCGCCATGGACGTGT
ACAACATGGAGGCCATCCCAGTGCTGATCGAGGCGTTCAGTGGCGTGCCGGTCAAGCAGATCTCGGCCGGCTACGACCACGCGGCGGCCGTGACGGCCGA
CGGTCGCCTGTACATGTGGGGCTCGAAGCTGTGGATCGAGCCGCGCGAGATGACGGCGCTGAGCGGCGAGCGCATCGTGCAGGTCGCGTGCGGTCGGCAG
TACACTGTGGGACTGGGCGAGGACGGCAAGGTCTTCACCTTCGGCAAGGGCAGCTCCAACTGCCTCGGCCACGGCGACCGCAAGAACCAGCTGCAGCCTA
TTCAGGTCCAAGCCGTCGGCGGCATCAACGTGACCTCGTACGTATATCCTTGCGTTGCCTTCAAGATGAGGAGTGAGTGACTAACCTCTGTCCGCTATCA
TGTTTGTTGTGTTCGATCAGTGTGTCGTGCGGCGACTACCACATGGGAGCGATCGCCACGCCCCACGCGGAAGCGACCGACAAGGATTTTTCCCTCCGCC
AGTAGCGTAGTAGACCACACAGGACTGCAAGTGTTCCCAAAACCCAAAAAATGCAGCACAACCGACAACTCCTGTGCTCTGTCTCGATATCTGTCGTGCT
CATACTCCAGAACTAACAATACAAGGATGCCGTAGCGACTGTCAGGAATCGACGAGCATCGAACATTCAGATCTGAACACCGTCGCGGCTCTTGAAGCTC
ACTCGCGATCTTTCCGCCTTTGCAGCTATTCATTCGGCCGCTCATTGCCAACTCTCAAGTATGGCGCGCTGGACGATCCGAGCGACTCTCAGCCTCGCTG
TGCTGATTGTAGCCTGGGCGTCCGCTCGCGTGCTCGACTGCTCGGTGCGGCCTCGTGCCGAGTCGCTTGCAATGTGGCGCACTGCTCACCACGACTCAGT
GCTCCGACAAGTGGATCGCTTCCTCACAGCACTCTCCAAGCGATTGGGGAGCGGCACCGACCGTCTCCGGTGGCGGCGCACCACCCTCGGCTCGGAGCTG
GCGCTGCTGGACAGGTGGGCGGAGCAGGACGAGGACCAAGACGCCGACGCCGACGAATGCATCGCCATCGTGCGCGACCGCCGCCGCGGCGAGATCTGCC
TGATCAGTCGATGAGAACACACAGACGAACAAACGGCGAGATATGTTACAGCTATGAAGCAACACCCCCAACGACTTTGCTGTCGGTGTCTACTTTGGCC
CAGGTCCGTCGCGCTTGCGCTTGAGGTTGTTGCGGCTCTGCATGGCCGCCGACCCGGTGCCCTTGGACGCCACCACATCCGTCACGACATACGGCGAGAG
CGCCGGGTCGACTGCCGACACCATCAGCGCGTCTAGAGGGATGGTGCTGCGCACGAGCAGGTTGACGCGCTGCAGCACGGCGATCGGCAGCGGAGTCACG
ACGAAGAGCACTCGGCGCTCGATATCGATCGCCCGCACGATCCCAACGCCGAGACACGGCGCCTGCACCGGCCCGAGCACGATCCGTGGCGGTCCATCGC
TCGGCGAGTGCGGAGCGCGGTCCACATTAACGCACAGCCCGACCAGACTGGCGTTGAGCGAGAAGAGCAGCTGACTGGGAGGCACCGACGAGCCGGCGAA
CGCAACGTCCACCTGGTCGAACGACACGGCGAACGGCGTGAGCCCGGCGTACGCGCGCGCGATCTCGCCGTCCACGCGGTTCTTCTCGGAGAGCACGTGC
AGGTTCTGCAGCTGGGCTCGCGGCAGGTCCCACGCACTGCGCGAGAGGAAGTACGTGTGCAGCCGGTAGAGCCGCATGTCCTTGGAGCTGCGCGCCGACT
GGGCCGTTCCCGTCGGGTCCCACGGTTCGACACGGTGCACGCGCCACTCGCCGCCACTAGGCACGTCGAACTGCTTGCTCTTGGTGGCGGCCAGCAGCTG
CACGACGTGGTCCGGCGCGGCCTCCTGGATGACGCTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCAGCCGTCCGTGTTGACGATGAGCGGGATCGGC
TGCTCGCTGGCCGCGTACCGCGCGCCGTACAGCCGCAGCAGGCTCTTGACGGCCTCCATGTAGAACAGCGGGTCGTTCCCGGGGTTGGCGCCGCCGCAGA
AGAACGCGCGAACCGGAGTGCGCATGTGCGAGAAGCCCGGCCCGAGCAGCGGCGTCGCAAGCGCGTGCAGTGATACCATCCCCGGCGGCGTGAGCTCCGA
CTGGCCCAGATCCGTGTCGAGGAACGCCACAACCGGAAACTGGACCAGCAGGCGGTTGAGCAGGTAGCGGCAGAAGGTCGACTTGCCCACGCCCTTGGCG
CCGCACACGACGATGCGGCTGGCCGTCCCGTCCACCAGGCTCGACTCCAGCGCATCCGCCGCCGTCCGCCACGGGTCAGTGATCTGCACGACGCGCAGCG
CGTCCACGACCGCGAACTCGGCCAGCACACGCTCGGGCGACTTCCAGTCGTGGCTGGCAGCGCGAGATGCCGATGGGGGAGGAGGAGCAACGGCGTCCCA
ACCGGCCGTGGCCTCGCGCAGGTCCGTCTGGCTGTACTTGGGCACGACCATCTTGAAGCCCGGCAGCACCAGCTCGTGCTGGCCGCTGGCGTCCGGCCGC
GAGCCCTCGAAGAAGCTCATGACGTTGCCGAACGTGACCGGGATGGCGCGGAAGACCAGCACGACGGGGAAGGCGTCGGCGAGCTCGGCCGCCAGGTCGT
CCGCCGCCGACTCCTCCGTCTCCAGCTCCTGCTCGCTCAATGTGATCGTCGGCTCCATGAGCGACAGCAGCTCGGCACTCGCCTCAGAGAACGGCGCGAC
TCCGGCGCCGCCGCCTGTCGATGCCGTATCATTGGGTCCGAGCGTCCGCAGCACCAGCAGGTTTCCCCATTTTGGCGAGTGCAGCGAGTAGTAGACGCCG
CGCCGCGGGCGGAAGCCCAGCACCTCCGCGTCCCCGCGGTATACGCGCACGAGCGCCTGGCCGGCGCAGTTGACGGCCGTGTCGAGCTGCGCGCCGAGCG
CGACGACGTTGCCGGAGGGCGAGCTGAGCGCTCGGAACCGGTTGGTGCTCGCCATTGAAATCGCTCGCCATGCGTCAATTTCCAGTAATTGGAGTATTTT
GGGTGATTCTTATTTTGGGGAGCAAAGTGTAGCCATATCAAGATGACAATCCTCCAATATGGCTACACTATTGAACCCTATGGAACGTGTGGAGCTTCTC
AACCAATATAGCCGCAGCAGTATTTATGCGCCAGCGCCAAATTCAGAGTGAGAAACGCATGTCGTCAATATTGCGAGTTTTGAGCTATTTTCACCTTGTG
GGCGACGCTATAACTCACCCTGGCAGCAGGGACTTTGAGGCTCGAGTCTGCCGCTTCACGCTGAAACGACCACGTGACCACCGGCGGTGGCGGTCCACGA
GAAAGAGCGACCGCCATGCTCCCGGCGCTCACGACGAGGCCGAAGCAGGCGGTGCGGCAGGTCCAGGGACTCACGGACGACTCGATCGACGCGTACTCCA
ACACGCCGCTGGGCTCCAATGGCGCTCCAGCATATGCGGACAACACCGATAGCGATACGGGCATCTCGCGAGCGTCAGCGCCGACCACCGCCAGGAGTTC
GAGTCTGCCAAACTCGCCGCGAAACACGAAGAAGACAGCTGGAGGGAATGGCGACAGTGCTCTCGCGCGAGTGGTGCGTGATCGGAAGGCCTCCGGCGAC
GACGACTTGTCGCTCAAGGTGGGCGACGTCGTTCGCGTGCTCTCGAGCAAGCGCACAGGGTATCTCAAGTGCGAGTTCGGCGATGTGACTGGCTACGTCC
CTTCTTCATACCTTGAGTTCTTCGAGGATAGTGTCGGGGCGGGTGACGACAATCGCGACGGCGGCGACTCCGAGACGCCACGAGCGTCGGAGAAGCGCAA
GAAGAAGAAGAAAAAGGAGAAGCGACGCAAAGACAAAGGCGATGAGGACGGGAGCGACCTTGGCGAGGCTGGTGAGTCCGCTCCAACGCCCCAGTCACCG
CAGAAGGAGACTGCGCGCCAGCCTGAAGACGGCGTGGCGACAGAGCGCGGTGCAGAGTCGCCGCGCAAGGCCAAGAAGAAGCATCGCAAGCAGCGCCACG
AGGACGAGGAAGCGGACGAGGAGGCGCCAACAACAAGTCGCAAAGCAAACAAAGAGCAAGAGGAGGGTGAGCGAACTCGCCGCAGCAAGCGTCAGGACAA
GAAGAAGCGTGAGCGGTACAGCAGCGAATCGAGCGGCAGCGACCAACCAACTAGCCGCTCTCGACGCGGCAAGAAGTCGCACCGCAGACGTCGCCGCCAC
TCTCAGAGCGGTAGCGGGTCGGACTCGGACTCATCCGCCGACTCGGACGCGAGCTATCGCCGACGCCGGCGCAGACGTCACCGACGGAGCTCCAGCGAGG
AAGAGGACTACGACAGTGACCAGAAGCGAAGAGCGCGGCGGGGTCGGAAACAGCGACAGCGCGATCGAGATGGCAGCAATGGATCGGACATGGAGCCCGA
GGCGGGTTCTCGATCTGCTCGAAGCCACAGTAAGAAACGCCGAGATCAAGAGGCCGCCAGCACGGCAGGAGCAGTTGCTCCGTTGCCCGAGAAGAAGCAA
GCCGACAAGGATATCCAGGAGACGGAGGCAGGGTTGGGTCGGCTGAACATACAAGACAAGAAGGCAACATCACAGAAGTCGGACATCTCAGACCACGTTC
ACGAATCGGTCGAGTCGACTGCTACCAGCAGCAAGGAGTCGACGGCAAAGACCAACAACAACACCGCGGGGACATCACAGTCAAGGGCCAAAGACTCGGC
ACGGAAGGACGACGAGAGCCGCGCCGAGAGCACTGCGGGGTCGACTCAAAAGAGCGGAAAGACCACACTGGGGAAGCAGATCGGTGACAAGATGCGGTCG
TTCCTCGGTGGCGGCAAGAAGAACGAGCGCGCCAGCAAAAACTCGAGCGGCATCCTGAACGCGTGTCCGGGCACTATCCAGGGCGAGGAGGGGTGGTACG
AGCACGGCGAAAATGAGCGCTATTACTTCGTGCTGTTGGACGGCAAGTGGAGTCTGCTCTACGGCCCCATGACCGAGGACGACTTTGAGCTCTACTCCAA
CAAGGTGCTTACACTATTCTCGTGCACAAGCGGGGCATGCAGTTTTATTGATAGGTGATGTGTGTGCTTTGGACAGGTGGCGGAGCAAAATCGCATGGTC
GAGTTGCCTCCAACGTACCTGCACAAGTCTGGGTACTTTTTGAACCGCGACTTGCGAGTGCAG