Description :
From Genome Similarity Track
Location :
Scaffold_440:8420- 12683
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_440-fgenesh-gene-0.1G10
Pytul_var.sporangiiferummaker-pug3_contig_440-snap-gene-0.83-oxo-5-alpha-steroid 4-dehydrogenase family protein
Pytul_var.sporangiiferummaker-pug3_contig_440-fgenesh-gene-0.2Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_440-fgenesh-gene-0.3NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9

Sequence
4263 bases(100 bases per row)
CAAGCGCAAGTGCGAGGCGCTGTGGCCCGTGCACCAGATTAACTGGCAGCGCAGTCGGTACGTGTACGACATGTTCTACAAGTACAAGCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCAATCTGATTGCCAAGTGGAAGAAGCCGGGCTACGAGCGGCTCTGC
AGCACGTTCGCGATCAACACCAAGAACTACAACTACGGTACGGTGAGTATCTGCCGCGTGCCCAAGCACCAGCTCTCGGACGACCAGGTGATCCAGGAAA
AGCACAGCGGCTGTCGCGGGTGTGCGTCCGGACCGGGCGGATACCACAACATCTTTGGCAACAAGTACGGGCAGTACCTAGCGCGCATCCAGATCGCACG
TGAGAAGAAGCAAGAGGAAGCGCAGGGCGGGGATGTGTGGGCGAATCGCGACGAGGAGCAGGAGTATGAGAGCGGCCGCGAAGAAGACGAGGAAGAGGAG
GAAGAGACGAAGAGTGACAGTCGAACAGCATCCACGAATAAACGAAAGCAGGACGCGAAAGAAGAACAGAAAGGAGGCAGCGATGAGTCTGAGTCTGAAT
CCGACAAAGAAAGCGACGCATCGGAGTCGGAAGAAGAGCCTCAAGCGACCAAGAAGCAGAAGAAACGCGATTGATAAAGCGCGAGAGCGTAGCTTTACAT
TATGGAACGCAAGCGAGGAGACAGCAGCATACTTTATACCAACAATAAAGAGATCCATTTTCAAAGCCAAATTGTAGCGAAGGGGGTAGTGGCATTCCAA
CCATTTCCCTCCTTTTGTGGTCATCGTAACAATTCCATATTCGCTCTCCGTTGTGCTCACAATTCACCAGACGCCAGGACACAGTTTCCATTTCGAGAGC
TTACCCTTCTGTTCGTTGCGGAACTTGGTGTCATACCAGTCCGAGTTGAATTTCGCCGACACGCACTGATTCGTGGCCACCCAGGCGCAGATGAAGTACT
GCATCGAGTTATGACCACCCGTCACCAATGCGAACGCCACGTAGAGCAGGATCTCGGTCGAGTACAGCGGGCACCGGACGTAGTCGAACCAGTCACCGTG
CGGGATCACGTGCCTATTATGGTGCCTGCGCTTTTGTGTCGCGATGAGGTAGTTGCAGAGCGCCTGGTGGTACGTCGCGACAACGAATAGGATCGTGCCG
AGCGAGATGCTCACGCGGCGCAGCAGCAGTGAGCCGTNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCATAATTGATTGCGGCGTCTGGGTCTGAGAGCAC
CGCAAGGGCCACACACAGGTAGTGTATGCAACCAAGAACAAAGCCTACAAAAGCAGAAAGTAGCAAATGAGTATGAGGAGAGCTCTATAGGCACTATTGG
GCATAATTTACCTCCAATGTGCATTTTGGAGTCGCCAAACTCGGTGATCAGCAGCGATTCCATGAATCGTCTGGCGTTGTGGAACGTGAACATGCTCAAA
AACACGATCACGTCACGGTTGATCTCTATCACGTGCTGCATTGGCGCTTCTTTATCAGTCTCAACTGGCACCGACTGCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATCAGCGGATTGTCCTGTGCGAACAGCACGAGCAGCATGATCGTCGCATTGTGCAGCGTGCCCAGAAGATAGAACCACGT
CCACCAGCTCTTCCCGATCTATAACACAGGCAACAACCCCACAAAACACAAACGCAGGTTACGACGCATGCAATGGCGCAAGCAGAACTGGATCCTTTTT
CGCAGTCAACGCACCTCGATTTGCAGCAGCGCAGCGCCGGGCAGCTGTGCGATGGCCGCAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCGTCACGAGCGCGCCGCCGCTGAGCGCCACCCACAGCAGCTTCCACAGCGCGCTCACGTCCATTTCCGCACTTTT
TTTCCTTCAGAGCCGCGTGCACTTTGTCATTGGGTTTATCCACCAATCGTATCACTTTAATTGCTTTTGAGTGTCATAATCGGCTAAAAATTGTAAAAAA
TGAACCAATCAGAGTCGGGATTAAGTCTCCCATTTTTAGCTCTTTGGCAATGGAAATAGACAGATCAGATCAATGGCGACGTCGATCTAAATGTCTAAAT
GCGATGCGCATCATGCAGCAATTCTCCTGCTTTGAAGTTAGCCACATACACGCACTGCTCGAACCTGTAGCAGCATTCCATATATACCGCCGCAATAGTT
CGATAGCTGGTAAGCCGCTAAATCACTTAACATGGTGTCCCGCGGGTCGTCGATCCACCACACGCGCCGTACGTCGAATCCGTTCATGACCACGAGCTCC
GGGATCGTCGGCATCAATCTGAACGAGAAGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTATGATAACAACAA
CAGAAACCAGCTCTCAGCGTCGGCGTCCGGAGGCAACCCATTGACGGAGTTCATGTACCAGACCACGAGTCGGCAGCTTGGCGAAGGCGTCCGCGTCCAC
GAGCGATCCAAGCTCAGCCAGCGCATGGACAAGCTCACGCTCCACAAAGGTACCGACCGCATCGGACATTTTCAGCTATTCGCACCATGCGCCGCCGCTG
GACTGGTGTTGTCAGTGGCATTTCACTTCATGTGACGTCGCTCTGCTTTCTTTTTTTGTGTACCTCGCAGAGGTGGACGAGAAAGGAAACGTGAAAATCC
GCCATGTCGACGTCGTGCAGCCCTACGACTGCACGCTCTCTCCCGAAGAATTGCTGCCGCAGCCAATCGATACGCGCTTCATCTCGGAACCGCGCAGCGA
GCACCCGCTGTACGCCACCAGGTACGCTACACTGCCCGAAATACTGTCTTCTTGCTTGCGGGTAAGCTTGCTTTTCACTGACGATGTCGTGATCGGATTA
TTGTGATTGCCATATTGCAGCACGCGTGAAGTTGGCGCCGAGAAATCACAGCTCAAGGTCGAGATGGAGCGTCTGGGGCGCCCGAATTCCTTTACAACGT
CCTTCAACGGCTTCCGCTACCGCGACTTTGGCTTGAACACAGCGATCACGAAGTCGAAAATCTGCGACCAACTCGACTACTCCTAGAGCGAGGGTCAGAT
GCGTGTTCCTAGAATATAAAGCAATGGGATGATAACAACACAACGGCAGGTCGCAAGCACAGGCTCTTGTTTCTTCAGCATTCCATTACCATCCTCTTCC
CGTGTTGGTTTTGTTTCTTTTTGTGTCTTTTTGTGTCTTTTTCTTGCTCTGTTGTATATGTGTCTTCTGCGCTTTCACCAAAGCATCGCTGACGGGGTTG
CGTTGTCCGATAATGCTCGTTGAGGCTGCATTCAGTTGGTATAATTACCGCCGACCGACACGCCATTTAGTCGTAGCCCTTCTTGGAGAAGTCGATGAAC
ACCGTCGGCTTCGCAGGCAGTGGCGTCATGTCAATATTAATTGCTTCCATAGGCGACACTTCGACGTCATCCGGGATCACTCCATCAGGGAAGCAAACCT
AAGCCAATACAAAGCAGAGCGCACGAGTTCGCACCATGAATAAATGACACGATAAATAAAAAGAAAGCATTGTGCTTTGCGGACGTACATCTAATGGGAT
TGGCGCGTTACGCATGAAACGGGTGCCGCCAGGCATGTAGTTGAAGACGTATTTGTCCGGGTGGGTGTAGTGCTCCACCTTCTCCTGCGCCTCACGCACC
AATCGCTTCGCAAGTCTGTATTATCATCATGCAATTATTTATATACACAACAACAGCCACCGCAGCACATACTGTCAGCAAACACCACCGGAATCCCACC
ATCATCCAACTATAAAACCACCGCAATGGCACATAGTACACAGCACGCCATATCGAAGCGCTGCCCATACGCGCCACAATTAAGTAATACAATAACATAA
TAGTCAAACAAAAAGACGCACCCGGAGCTTGGGTCAAGGTTGCGGTTCTGGTCGAACTGCGCACGGATCTTGGTGGCCTCCTCGTTCCAGAGGCGGCGGT
CGATGATCCAGCTGTCGAGCGTCTTGAGCGACTGCTTGTAGAGGCGCTGCACCACCTGCTTGTGCGAGAGCTCCTCGGCGGGCGCGCCGAAGCGGGCCAC
CACCTCGCGGAAGGTCTTGTTCATGTTGGCGTTCACCTTCATCGTCACGCGCTTGTTGCTTGC