Description :
From Genome Similarity Track
Location :
Scaffold_129:8420- 40972
Transcript NameFunction/comments
Phypl_g3779hypothetical protein
Phypl_g3780conserved hypothetical protein
Phypl_g3781hypothetical protein
Phypl_g3782hypothetical protein PHYSODRAFT_308450
Phypl_g3783conserved hypothetical protein
Phypl_g3784sporangia induced hypothetical protein
Phypl_g3785hypothetical protein PHYSODRAFT_553660
Phypl_g3786conserved hypothetical protein
Phypl_g3787hypothetical protein PHYSODRAFT_320741
Phypl_g3788hypothetical protein PHYSODRAFT_320742

Sequence
32552 bases(100 bases per row)
GGAGTCGCACTTGCTAAGCGACGTTTGTGAACTTCATGGCGTCGGTGCGGCGTGTGTTGCTcgctgcaagcagcagagagGAATGCGATGCATTTGATCA
TTTCTGGCAGCCTCAAGAACCCAGCACCGAACAAGGCTTGGACGTTGGACGTCTGAGCTCTGAACCGCCAGTTCTGCCACGTGACGGGAACGACGAAGGC
CGAAACAGCTCGCAGTCGTTGTTggaggatctgctgctgtatTTGGCTGTTCGAGAGCTTGCAGTCACAGCCGAATCAGCAGGAGAGAAGGTGATTCTAG
GTGTCGATGCGCAGACTTTGCAGCATTGGGAGCAGTGTGAAGGACAGCAACGTACACAAATCAAGAGCTATGTCGAAACTTTGCATGGGTAGGTAGGTTG
TGGAGCTTTTAGGTTTTGACTGAAAGAGTCTAAGCGTGATATGATTACTTTCTATACACAGACTATTGCTGAAGAGTGAGTGGAACGCAGTGAGCGTCGC
CACGCTCGGTCGTGTCGTAAAGCGCCTGCAGAATCCTCGGGCTCGTCAACGCTTTCTAGCGTTCGCCGTTCAAGTTCTCCAACTAATATTGCAATCCAAA
GATTCACTCCCGGTATCGAAAGCGGGACAATTGTCCGATATGGAGGTGAAGTTATTTGATGAAGCAGTTCGTTTGTTGCTACTTGGAGCGACAGACTTGT
GGTCGGCAATTCGGAAAGACTGCGCCAAGACGGCAGCGGTTATTGCGTTTGAGTTCTCGTCACAAAGTCATATCGAGCAACTGATGGACAGTTTGCTCTG
TGTCGCTATCGGCTCCCGAAGTGTTAGCGCTGACAAAAGCCAGGTGACTGCGTGGACCGAGAGGGAAGGCGCTTTGCTGGCACTATCAGTTCTTTTGCGC
TCCATCGTGATGGATTCAACTGGCCGACAAGTCACAGCTGACAAAGAGACCGACGTTTCTCAGGTTAAGGACGACATCAAGGGCATTTTGGGCGTCCGGC
AAGTATCAGGCGTGAGGTACCATCTTGGCTCGAGACACACATTGACCCAATTGCCGCGATGCCTCGTGCAAACGCTGAAACCTGCGATGTATCAGTGTCT
TCGCCATGaccagcttggcgttcgACAGCTTGCAGCGCAATGCCTGGTGGAGTATGCTACACTTTGCGAAGAACCAACACGGCTGCTTATTTTTCAAGAG
GTAATCAGCAAACTGAATCGTATCAATCGGAACGAGAAGGTCGCCGAGGGTGATTCTGCTGAAAACCCCGACGAATCggaactgctggatgcgTTCGAAG
CTGAAGGTTTGCTGGACGTGCTAGCTCGGATGACACCGTGTCTCCCTTCAACCTTTTTGCTAAAGCACTGGAAGTTTGTGTTtccgacgctggagaagta
TGTTATGCACATCGCATCGAGTGTTCGTcagaagagcagcagtgTTGTGTTCGCACTTGCAATACAAAGTTTGAGCCGTGAGGTTTTGGCTTCAAGtgcg
acttcaacttgcgaGGAGGCTTCCTTGAAGCTGGTTGTGCAAATGCTGCTTTCGCTGTCCAGACCGCAAAGTGAGGCAGGCGGTTTGTGTTGGCAACGAA
AAGAAGGTCGTTTATTGAGTATTGACGTCCTCGTCAACGTCTTGGGAGAAAGTCTTCTGGAGTGCAGGAGTGACGCCTGCAAGCTGTTGAGGTGGAAGCC
AGAGCCTACAAAGTCGCGCCAACGCCGTTCAAGCTCACTTGCCGATGTGCAAACGTATATGTGGGCGCATGAACAAGCTCGGTCGGCCACGTGGGTGCTA
GACACAAATGAAGTGGAGAGATATCAAGCTGACGCCACAGCGGAGAGCAAGTCACTTGTCCATACTATTCGCATTTGGATCGAGAAAAACAATACCCAAG
ATGGCTTGCCTGCCTCTAGCCATGAATTCTGGCAGCAAGTTCTGAGTGGGTGTATTGCACAAACCAAAGAGGTGTTCGAGTCGTCTCAATTCGAGCTTCG
CAGAATCTCTCGCCAAGTTCTTCCTGGCTTAATGAGGCTTGTCATTTGGGCAGACCAACTCACTTTCTTAGCATCGACTGAGCTCGAAACTACATCTGGA
GAGACGTCATGGGGCTGGATGTGTATGAAGTATATTTTACTGCACTTACGTTACCTGGAAGAGAGCATGGTCGCGTTGGGTGGGAATGTTGAAACTTCTA
CTTCGCAACAGCTAGCAACGAACTGGGAAATTGTGTGGCGTGGCATTGTTGCGCTGGAAAATAATGCACAGTGTATCTCCACTGAATCAGAAGCTACTGT
GGCTAAAGTGGAAGTGAAAATGATGGCATTTCTTAGCTTTGGGGCGGGGGCAGATCCACCGCATCAAGTAGCCCAGTTTTTGGACGGTGCCCTGAGATCA
ATTCTCGGCCACCTTCCTAAAACaatgcagcttcgagcacaGCTGGAGGCTGAGAGTGCATCTTTAACTAACGATAGTTCTCTCGATCGCCAGTTTTGCA
CCTTCCTAGTGCCCATTCTTCCAGCGGTTGTGAGCTCACTGCAATACTTGGATGAAGGACACGGAAGGAATGATTCCAGCTCGGGCGATCGTATTCAGTC
ACGTGAGGTTGACCTGTCCAGGAGTTCTCGATGGTTGTGCCTGGAGCGGGTCATTTTGTCGTGGCTTTTGTGTGATGACATGTTCCGGTGGATAACACTC
AGCAAGTCGGAGGCTCAATCTCAGCTTTTGGAAAGCCTTCGTATGCTGCTTCACTTCCCGAGAATTGATCTGCCGCGTGGAGAGGAAAGTGAAGAGATCG
ACAACATTACTCAGTGTCTCCAGGAAACCTTCGCTGCCTCGCAGACAAAAAGCACCCGAATGAAAGACGCAAACTACACTTCCTTGATGGACATTTATCT
GCAATTGTGGTTGCGATGCATCCCAAAAGGCTGCCACAGCACAGACAAGGTGGTCGTTATCGTTGTCCAGCTTTATAGCCAGAGACAGCAGAATATTGCC
TTAGCTGACGCTAAAACGAAGCGTGGTGCGAGCAATTCGACGTGTGCGGCAGCAGAATCGTGGGGCGATTGggatgacgatgaggacCAAGTTCAGGAGG
CATCTCCAGTCGGTAATGCTCAGGACCTTCAGGGTTTGCCTAGCTCCGACTCTCTGTTTCAGGAAGTACTAGAGTCTCTCGATGTTAGCCAGCTCAACCT
GTTACGCGAGGCAGCGCGCGGTATCCCAGATCTACCTGGTGTGAGAGGCCTTCCAACTCGAGATATTACACGAATGCAGCAACAGATCGAGGCTTGTCTC
TAGACCTAGTAATCCTCCACGTCATCCCTCCAGAAGCGTAGTGTAACACGTATATTCATCAAATACATAAGCCTTGTAGCCATGTATCAGGCTTGCTTCT
CCTTTCAAACGTGCAAAAGCTCCATTGGCACCGTGCCTAGTCTTCGAATTCTAGACTTAGTGCACTTAGCTCCACCAGGTTCCACATCCACATACAATGT
GCCAGCGCTAGTACCACCACCAACACCGATAACGCAATTTCCCACGTCAACATTTCTTCTAGCATCCCCTTTATTCTCTCCTCTGGTGTCTCCACTGGAG
AGGAATTCGTCTCCACCTCACTTGCTTCCGATGCGTTTGCCAATCTGTCTCCAAACGGTCGTAGTAGCTCTTCATCCCCACTACTTTCATCCAGAATGCT
CCTCGCTGGTACACAATCGCTCGAGTCAAGCCTCCTACCTCGTGGGCCGTCACTGGTGAAGTAGTCGACGATAATCTGCTTGGACAGCGaggcatcagca
gcagccagtagAACTGTCGTACCGAGAGCTTGGTCCGTCGCGTCGGTCCCGTTTTCGAGCGTTGGCGTCGTCTCGAAGCTACTCGAGTCCAtttcttgtt
cttcttgatcagCACCAGGTCTTGGTGTCGTGAACTTCTCGTCTCCTGCCGGTCCAAAGCCGTCAGCGACAGTGTCCAACCGTCGCGCCCTGTTGACAGg
tttgagctgcttcaagaTACTTTTCCCACCTTGAAGTGGCCTGTTCGTCGACAGTACAGCAGTGTAAGTTACggaccaagcagcagctcgcgtccCGTTT
TCGTGACTGGTGATGGAGGCTTCAAGCATtaacgcagcagcgcaacgcACGCTCCGCTTCGTGTGCGGGTGTCGTGCCGATGGAATCGTACCAGAAGCGT
ATTGTCGGGACGTGGAGACGGCTGCAGAGCCGCCGTcgaagcggcagcgcgtGGGTGAGTCTTCGATTGTCGAGGTGCGTCTTGTCGAGCTAATTCGCGa
cctggacgaggccaacgaTGACAACGACAAGCATTACGGCCTGTTTGTATGGCCGTCGGCGCTGTTATTGTCTCGCTTCGTTGCCCGGGAAGCAAATTGG
CTCTGCCGCGATAAAGTCGTGCTGGAAGTGGGCTGTGGCACAGGACTCCCGTCGATTCTCGCTGGCTTGTGCGGGGCTGCGAAGGTCTATCTCACGGATC
gagccgacgctgccgacaTCCAGCGCAACGCAGAAGCGAACATCAAACGGAATGGACTTGAAACTCGTGCTGCGTTTATCCCCTTGGCCTGGGGCGACAT
GCTCAtctcggacgagctcatttcCATCTTCCAAAGTGTCCAAGTCATCCTCGCTGCCGACTGCTTCTACCAATCTCAAGGTGCGACGAACCACTTCAAA
TTGCTGCTCAAATTCTGTCAACTTAGCGTGCATTCTTACAGATTTCGAGAAGGTGATCCCTACTGTGGCGCTCATCTTCCGCTGCAGTGGTGGTCCAGCC
TCGTGcaagttcttcttcacctACCAACTGCGCAGTATCAGCCGGTCAATCGCCCCCCTCCTCTCTCGCTGGGGTCTGACTGCCAAGGCAATCGACAAAA
GCGAGCTCGTCAGCGACTCAAACGATATGGACGACAGCTCCGCCCGGGACTTTGACAGCGTCTACCTCTACGAAGTCCAACGTCAACACTAACATGAACT
ATGATGCAAATGGGTGGCTCAGATTCGCCTTTTATCTTCTGTCTCTCACCGTTCCCTATAGTGTTTTCCAGTGTTTTCCAGTAACTTGGAAAATGTCCCT
CCCCTGATCTAGAGCACATGTGCGTGGGGCtctcgcagcagcctcttcaGCCTTTCAACGGGAGATTTCCTGTACCCCTCAGCAGATCCTCGTGACACGA
GTGAGACCGTGGAGCTCTATCGTCCACCCGCAAGCACAGAATCGCCTAAGTAAATGCTACGGGGGGGTTCCTCACGGAACTCGAGACTACAGTACTTCTA
TCATCATCGCCAACCAACAGTACCGCAACCTACAGACATCTCAACTTTCCGGATATGATACTGTCgttcgtcttctgctgccAATGTGACCTTCCACGCT
GCCATTGGTTGAAAGGGCACATTTCCCCAGCCAATCAAAGCACGTCGTATATGTGGCCGTGGGTCACCGCACAACTCAAATCTTCCAGGAAGCGCATCAT
GTTCGCCCGAGTCGCCCGCGTCGCctcgctcgccgccgtccgccGCACGCcctccgtggcgctgcgtgcgctgcagACCCGCAAGGAGTCGTCGCTCACG
TCTCTGCTCAACGTGCGTCCTCCAATCCCCAAAACTCCGGCCGCAATCCTCTAAAACCTAGCCTCCATGAGCTAACTTTTACTACTTGACTGTTGTTTAT
tctttgctgcagcgcgaggtccaggaggagaaggccaactgcttcgaggagcaggagctggaggacctGCGCgtcaaggtggagaaggtgttCAAGCTGA
AGGATACCGCTGGCTGCATGGAcatcctgctgcagggcacGTCAGGCGACGACTCGATCACCATCAAGTTCAACGCCCAAGACaccatcgagctcgagga
cgaggaggactacgacgatgacgaggaggacgacgacgaccaggagcagtcggacgacgacgaggaggacgaggacgagctccCGGGCGTCCGCTTCACG
GCCGACATCACGCGCGAGAACAAGGGCCTGCAGTTCgactgcgtggccagcagcaacctcACGGTGGAGCGCGTGCGCTACCTGAGCGACTTCgccaagg
aggccgaggacgagacgcTATACTTCGGCCCCAACTTCATCGACCTGGAGCTCGACGTGCAGGACAAGTTCTACGGCTACCTGGCCGAGCgcaagatcga
cgacgagctggcgcagttCATCACGCAGTTCGCCGACctcaaggagcagcgcgagtacCTGGCCTTCCTCGAGAACGCCGAGACCTTCGTCAAGCACTGA
ACACAACACTCGTAGCGTATTGTTGCTTGAGGCTGTGACTGACTTCCCCACAAAATAAACAGCTAGAGCCTCACTCACCACTTGGCATGTATAGTCCTTT
ACAGAGTCGGTCTGCGAGCGATTGGCGGGCTACGTCGCTATTGCTGTTTTTGCTGTCTAACCTTGCATCCGAGACATCACGCTCTGCATGAGCTGCGACA
CCTTGGGGTTCGACATGTGCCGCATAGCAGCGGACGGGCCTTCGTTGTCCACGTCACGGAAAAAGTCCGCCAGGTCCGGGTCCGATCGCGCTGCCATGAG
CTCGGGGCTGTTCATGAGGCCGCTCATGTCGGGCATGCCGCCGCTTCCTGCGCTACCAGCACTCGGGGAAGCGCCACCGGcaccaggagcagcgcctcca
gcaccgccaagACCACCCATGAGGTTGTTGAGCATGTCGGGGTTCTGCATCATGTTCTGCGCCATCTGCATCATCTGAGGGTTCTGCATCATGCTCTGGG
CCATCTGCATCATTTGCGGGTTGTTCATGAGGtcgccgaggccgccgccaccaccaccgccgccgccgagcaTGCTGGCGAGGTTCGACAGGTCTGGCAT
CcctcctgcgccgccagcaggagCCGATGCCGCAGGCGTCGTCTGCATCTGGCGGAGCTTGCGCTCAGCGTCCGCAAGTCCATCGCGGCAAGCAGCGTTG
GTGCTGTCCACTTCAAGTCCACGTCGAAATGTGTCAATAGCTCCGTCAAAGTCCTTTAGCTGCCCCTGTGCGCTGCCCATACGGGAGTAAGCCTTCACGT
AGGACGGTTTGAGGGCGATCGACTGCTCGCAGTGGTCGATCACCTCCGCGTACTTGCCCAAGTACATGAGCGCCGCAGCCAAGTTGGAGTGGTAGATATG
GGACGACGGTCCGTCCggcgacagctgcagcgcctcgcggTACAGCTTGGCGGCTCCCTCATAGTCCTGGCTGCTCAGAGCGGCATTGCCCTGAGccttc
acctcctcggccttggcctccttctcctccttggacaGCTCCGGCTTCATGTCTCCGAACTTCTCCTTAAACTTGACCAGCGCCTTGTTCGTGCGCGTGG
CATGTTCAGCGGTACCAGGAGCCGCGCCCTTGAAGAAGCCCTTGctctccagcttggccacccACTTCTTCCACAGCTCCGGgtctgcaacagcagcagc
ataaTAAATAATTAGCCAATCAGAATCTATCACTTTCAGGATCTGCCACGTACGCTTCTTCACGACGGGAtcctcgtccaccgccgACTTGGTCTCGCCC
GTGCCGGTctccaggtccagcgccttgagccCAGCAGCGAAGATCTCGTCGAACGAGGCCTCGCCGTTCACCGCCAGCTGCCGCTTCTGCTCTGCGTCGt
gcacgtccacgccgaacGCCTCGCTAAGAAATAATTAAGTAAAAAATAAAATAGAAGTTAGTAAAGATCGGGATTTTGCAGCTTATGCTGCGAATTGGAG
CGTGGGGATTACGTGAGGCGCTTCAGGGCCGCGTCGACTTCCTGgacgtccacgccgtcgtgcgTCTTGAGCGCATCCACCCACGCCAGCGCGTTGAATA
GCGTCGCCTTGCTCGCCTCGTTCATCGTGGCACGAAGTCAATCAAATTCTCCCCTTTTCTCGAAGCCACCAGCAAAACTGCAGTCGTTGGATTGGTGAAA
ACGGTAGGATTGGAGTCACGTGATTGGTCAGTAAATCGAGCGAATCAAATGTCGCCGTGTTGGAAAGATCGGAGCACTTCAaccaagatggctacatttg
tgatccaagatggaggaggagacggtCGCTGCTAATGAGGCAGCGATTCTGGAGCGGCGCCACGAGATCCGCACAAGTCTGAGGGCGGTGGAGAACTCGC
TAAGAGAAGCCGGGGCTGTCACGGATGGATACAATAGCGTGTACCTGCTGGAGTCGCCCACTGCTCATTGGGGCGGTCTCCCATCCAGTTCACTGTTCCG
TCGGCAGGCTGTGCACGTGTCCGAGGCGACTTTGGCTCGATCTGCAGCGCATCGCTTTGACTTCGATGCCCCTGATAAAATCCGGCACGAGTGGAGACTG
TCTACATTGGGTGAAGCCAAGTGCCGACGGATTTGGAGTCTCTTTGatgccgacgaggacgagaggTGGACGCACGGAGAGTTCCTCGAATACATGGCGG
CGTTGAAGTGCTCAAGTGACTCGGTGGAGCTAAAGGCGTTTGAAGACAGCGCGGAGGTCTGGGGAATGTATATGAGCGACATgtgcgagctggacgagga
agGAAAGCTTACGTTCGAAGGGTTTGAGAAGTACCGAGAGCTGATTGAAGACGAACAGCCACTGGAGCGAGATTTGGCGGCGTTGGGGATTTCCCTAGAG
TGGGAAGAGTTGGAGAGGATGGAGAGGATTAAGCAGCTTTTTGATGAGTACGTGGATGATCCGACGGGTAACGTGACTGCTAAAGCTGCACAATATCTGT
TGGCGGAGATTGGATTCGTGCTGACGAGTGAAGAGACGGCGGGGATTATCGAGAGGAGATACCAACTTGCACGATGTCAGCGCTTCATCCATCAACTAAA
ACGTACGTTGCGATTGTTTGGGTACCGACAGAAGTCGGCACTAAGATTTACGAACGAAGGTCTTCCCACGAGTGGAAACAGAGAAGAGCAGCCTCGAATC
TGTAAGGTTGGGCTGCTGAGTCTGGTCTTTTCGCCGTGGTATCCGGCTACGAAGACAGTAAGTGGGTGCTTGATATTCCACTTGTGAGTAGTGTTGCTAA
CTATTGTAACCGTATAGCGCTGGCGCAGATTCTTTTTGCAATGCCGCCTGTATTCCTTCTGTGCACTAAGACGGTTCAAGCGGCGAGTTCGCGCGGCTCT
CATGTGCGTGTGGCAAGTATCAGCTACAGGACTGCTATCGGCAAGCTGTCTGCAATCTCGTACTCCTGGGGGTGACCGCGGTGACTACATGCTAAAAGTT
GATATAGGACCCAAGTTTTCAACAACTGCCACCATTCATCTCGCTTACAACTCGGACGCCGATTGTAAGTGATGTATGTATCTTTCCCGTTCACAGCACT
GAGAAACTAACTAGGGTCGTGTGTTTAGCTGCTGCCACGCTTCATGAGCTGAAATGTCTGGAGCGCGGCGCGGAATGTTTCCTACACGTAGATCTGGCCT
GTCGGAGCGGCACGAAAGGTTTGTACTTTTGTAGTAAAGGCTATATCGAATCAACTGCCCCCACATAACATATTATGTTTGCAGAAAGCGATGCTCACAT
CCTGGTTGACAAGCTAAATTGGTTTATTGGGGAATTTTTTCGAGACCAcatcgagtcgctgccgTTCTTCCACCGCTGGTTTGTCACGATACCGACAAAG
CAGCAACTACGAATGGGGCCAGCAAGcagtggagctgctgggacGCCGTCTGTAGTCATTCGTCTGGTGATCTTGTTTACAGGCGGAATGGACCTGTACC
ATGTAATGCAGAGCCTCGGACTGCCTTCATCGATGCAGTTTGatcacctcctccagcgatTTTCTTTACGTTGTTCGGGCAGTCACTCACTGGAAGATCT
ACTTGTAACGAAGAATCTCAACCTTGGTGCTCAATTGTCTTGCCGAACTCAAATGGACGTCCGGCTGAATCGACAGGCGTGGGCTCAAATTTTCTCTCAA
GTTGCACACCAcctcgacgccaagctggtcCATGAGCGCGAGGACGCAGAATACATTGCACAAATTAAAGCTGAACGAGagcaaaagaagaagaagtcgg
tGGTGCTGAACCAACGACGGCCGTCGGTATCAATTCGACCCGGTGACAGTCAGCAAGAGGAATGTCCACGACGTTCAGCAGATCGAGAGAAGAAAACGGA
GAGCCGCCAGTATTTGCTGATCAAGTCGCTTCGTCGTGTggctcgagcacttcaacactcgcagcagctgagcTCGACCTGGGCGTTTACCAACTTGGGG
TCTGCACTTCGCGAGAATCAGTGGTTTCATCGTGTACTCTCGCCAGAATggcttgagctgctgaagtaTGTTCTTGACACCCCAGGTGGGCTGGCCGAAG
AATGGAAAGCCAAAGGAGACTCATTGCGTGCCGAGTTTGCTGAAACTAACTACGCAAtggctggagctcgtccCGTGCTGGGGCACCATCCAACTTCACG
AACAGCAAAGTCGTCAACAGAATTCACCCTTGATCCCTTGTCTGCAAGTAAAGCCCCGCCAACAACGAGGTCGTCCGAGACTCCAAAGCTTACAGCGCGA
CGCAGCCATATCCAGCATGAATCAAAGCTGAGCCATCTTCAGCATGAACCGAAGGTGACAGCGCGACTCAATCACGAGCCAAAGCAAACAGatcgccacg
gccacgatcCGAACCAGCCAACCACCAACGTTCCAGAGTCGACCGAGGAGAAGAGTACGGAGGATTTATTGCTGGAATTTTACGACTTGTGCGCCCGACA
CCTGCAAGGAGTTCACGTTGTTCGCGCGGAGGCCGGTACAAGTGGCGTCACGTGCACCCTCGAAGGTTGGGACATCTTCAGCTTGCTGCCGAGGATTCAC
CAGGGTCAACTCGCCAGGAAGGCTTCCTTGATTCGCTCCGGCACGTTCTCCTCGCGGCAACCTCTTTCCAGCCGAAGCCTCAACCCAGCAATGGGTTCTA
GTCGGGAGCTATCGATGAAACACATGCACtagtactactagtagtaatTTGCGGTCCACTAGCAGTTGTGCCAACAAAACTTTTCAAGTCCGCAGAGCAG
TAGGCTCTTGATACGAAAAACCAAAGTGTATTGTTTCATCACCTCCACGAAAATACTACAGCAATCCTCGAGCAGATAACCTGGCAACGACACTCTAGTA
AATCCCTACTATTAAATGCAAAGCTACTACGTGACTAGTTGAATGGCGGATGGTCAGTGTAACTATGACAAAGTGTGATGCTCACAGAAGGAGGAGAGAC
CAAAACGGTCCTCGCTCCTTTCACTAAGTAACGAATTCGGTATCTTCACTCCATCGCCAGCGCGCGAACACGCTCTATAATAATACACAGGTACACGGTA
CAGCACACACACGCAACACGCGCGCCGAAGCCTCCAGCCCagcgcttctcgtccgcTGGGGAAAATTCGATACTGAGCGACGAGAAAATGCGTCACAGCA
GCCAGCTTCGTCGGCTGACTGGTCAGCAAAAGCCGAAGCAAAACTCGCCGCTGATTCGTCGAAATCAATATCTAACCCAAATCAGTACTCCGAACGTCAC
TTCATAACGCCATTAGTTTTAAACTCGGAACGTTGTAACATGCTCGAAGATCGGCttcacgtgctggacgtTGACGTGTCTGTGGAGGCTCCTACGCGCA
TCGGGCCCCGGATCCAAGAGCGTGACAGTCAACGCATCGCAGTCTGCCATAAAACCCGCGTGGTTGCGATCGCCAATGGCTGCTTCGTCGACTTGTACGG
CGTCTGTAACAACAGTTTACACCCCTTCACGCCCCTGCAGCAGATCTCCATCGCAGAGCATGCAACGCACCTACCCAGCTCCATTTCGGGCTGCAGTAAC
GACCCAGAGTTGGGTGTTGCGGTGGCTACAAGTGTGGCGTTCCCCGTCCCCGGTCTTCTGCTGGTCGGGGCTTTCGTGGCAGTTCCGGAATCCGAAATTT
CGGGAGCCGGTGGTACAGTCAACTCCAGTAGAGCAGCTTTTCTCCTTGGGTTCCGGCTGTATGCGGGTTCTGTGACTCAGTTTGTCGGTGCTGTGGATGG
CAACAAGCCTCGTGAAGTTCCAGCGTCCGTTCAAGTTTACTTTATTTTCCTGGAACCGGTCGTGGGCGCTGGTGTGAAGAGTATTCGCTGTTTGCAGAGT
TTTCGACGTGACATGACACCCGACCAAGGATCTGTGCTGGTTCTCTTTGACGACTCTATAACGTTTGGAGTGCTCAGCTGGAAAGATCGGTTTAGTGATC
GGTGGATGTGTCTGGCGCAGATGAAGCAGCCATCCGAGAGGTTGGTCGTTGCTGAGTGCAGTCCGGATGGTCGGTATCTTGTagttggagacgctggagg
gcGACTGTCACTGATCGATTTTAAAGACTTTCCGCGTGACGGGTACGAAACGTCTTCAAGGCCACATCAAACAATAGGCAAGCGACTGGAGTTAGGAGCG
TGCTCTCGGTCCGGTGTGATAACGCGTGACAATCCACTTGAGCACGCTCGGCTTGTTCATACTACAGCAATCGCTGGTGCGGACTGTGCATACACAAGCC
TTCGGTGGTGGGTCTGTGGTATGCGAGAGCAGCTAAAGCAATTTGTTCTTGCCGGCAAACAAGATGGGTCGTTGCATGTACGTGACTGCAAATGTTATTA
TGactgaagttgaagtgctcacAAGTGCCGTGCTAACTGACAGATACTAAAATTCATCCAAGGCGAAGCAAGATCTACCGTTGAACAGAAACCAGTTCAG
GTTTGTCGAGCTTTCTGGTCGTATCCAGCCTTCGATTGATTCCTATCCGTGTTGTCCTTGTTTGTTGTACTCTGCAGATGTTTCCGGGTCTAGCGTCGGG
AACGCACGATGCCATCCGAAGCATTTCTGAGCCGATAAAAGTTTTGGGGGATAACTCGGCGAATGATGCTGGTTTTGAGTTCTCGGTGATCTCAGAAATG
CGTTGGAGGACTTGGCGGATAAAGATTGCAACGGATGATGAAGAATTGTCCAAGCGGTATCGTATGATTTGGCCGTCGATGAGGGACTCACTGGACTTTC
CGTCATTTTCGGTGAGCATTTCGAATTCAATTCATGACTCGCGTTGTAGTTTGCTACGCTCACGAGTGATTGACCGATGTTTGTTCATTTCGTGCTATAG
ATCCTTCTTAAGGCCGTTAATGGCACTGTTCTGTTGCCAAGTGGGTCTAACCTTTCAAAGCTTGTCGCCAAATCTCTTCTGGATGCATCCCCAGACCACA
CTGCTAGGTATCCAATAGCGTTGATGATAGCCGACAACCACCTGCAAGTTATTGGCCTGCTAACGAAGGCACCAGTTAAGACCGTTGAGACATCTTCGGA
GTCTGGGATCGAAGCTAGTGATCTCAACGAGAACGAAAACGATGACAAAACGAGCAAGCGTGAGGAAGTTCAAGCGGAAACAGCCACCATTGATACTGAA
GAGAGATCCGACGAAGACCGCCGTCCCTCTGGCCCTACAACAATTCAGGACAAGTATAAGCTTCCACCGATGCAGTGGAAGACTCCAGGTGCTGCTAACC
TGAAAGACGATCGCTTGACTAATGGAAAAGGACATGAAGATGTTCCACTCCAAACTGCACGATTGTCAAAGCTCAGTCGCGTAGACTACAATGAACGAGT
CGTGTCCGCTATGCAACGCGTAGAGACACTGAGCGGCGTCATGAAATCGATGCGAGCGTCTTTCCAACTGTTTTCAAGTGATGTCCAGCACCACATGAAT
CTCGTTTCGGAACAGGTCGAGGAAATTAGCCGCCGACGAGTCACATGAGAAACTGCTCAACGTTCTCGAATCGGCTGAATTACCGAGCAGACTTGTTGCA
TCAGAAGCTGATCATGGAGAAAAGCTACcttcaagcgcaagctgagGTGGCTCGCTtcgatgctggagcacgaccacttggagatgaagctggtTCCAAT
AACCAGACCCCCTCGCCTGTGATTTCGCACGTAGCGGACAAGTACGACCCAGATCACCCCGATGCTGACTGGGGGGGCTACGTGCGTCGTTCGTACAAGA
AGCGCTTCTACACGGATCAATCTGGCGTCAAACATGTATAAAAGTACCAGTCTGGTATTGCGTTGGGTATTAACAACGCACTAACTTACTGTAAATATTG
AAATGTGCTTCGTGTAGAGTCTAACATACGATGAAAAAGGAGGCATCATGCCTCGAGATGCGCCCGAAAACTCTACGATGTCGGGAAAGAAGTTGTTCGA
GCCTCAGCAGAATCCATCGGGCGAACAAGTTCCTGGCATCCCTTTCCAGACTGCTGTTTACCAGGTAAACGTTGCCAGGACTCTTGTCTTTTGAAAGGGA
TTTTAAACTGATCGACCACGTTGTTGTCTGTAGGTTGGACCTGGCAGCAACGTTAGTTGCAGTGATTGGAAGAGGTAAGTGGATGCCTATCAAGTGGAGG
GCGTCAACGATCACACCGTGACAATGAACTTGCTCCTTTAATGTAGTTCGTACGCCTCGCAAACGTCGATGGAGGCTACGCCCAAAGACAGTTTCGTGCT
TGGAACGCGGCAGCATTCGCAGCACAAACGCCACGTGACGCCGATGGTACGTGCTATTCCATCCTTTCCCCTCACGCCTGTGAGCTGATGCCATCACTGT
CGTTTGCCGCTGATCCAGTATGATCAAGGTCGTGGATCACGCCAAAACTCTGCACGTACTCAATCACCTTCAACTCCGTGGGAAGGTCGACAAGGTTCAC
CATCGCTAAATcaaagtggcagcagcgggtcgcTTTCTGGCCGTCGCATCGACTCGCGTCGCTCCCTCCTCGCGGGTATCGGCAAACTGGTTGCAGCTGA
GGACCTCAGTGGAATACAACCGTAAGTTTGCGTTAGTGCGCACGATTACAATGAAAGTACCTCATGATTCCTCTACATGTCCAGCCCACCGGAGCGTCAT
TTATCGGAGAGTTACGCCAACCCCGCGTCCAAGACACTCCTAGCAGAGAACTAGTGAGTAGATTCTCATGTACTACCGGTAGTATGTGAACTTAGTCTCA
CGTTCCTTTCTGTGCGATTCTGCCAGCCACGGGACCACGTTGGGGTACACTGGACGTCGAAACATGTACTGAGGTGAACGATAAGGAAGTGGTGGAACAA
GTAAAACGGGTAGAAGGTATTGGTTAAGAGAGTAACAATGACACTTCATCAGCGCTTACATCCTACCAGCAGGTCCAGTGTCGTGACTACATGGAGCGCA
TGTCAATTCGTAGCGCTCCGAAGCTGATCAACGCGCCCAAGAACGAAAGTGCACCCCCCACAAACACTGGCAACGCGTATCCGAGCGACGTCTCCACaag
tgcagcaccaaccaAGAAATTGAGCAACTGGCCAACACAATTGGCCGAGTTCACAGCGCCAACATACATGCCAACGTGCGCGGAAGTACCGAAGATGTGC
ACAATGATAGGCACGATGAGTGCGAAAATCGTGGCCTGCGTGATGGCGGTCAGGGAGACAatcgccacgtccacggcgaCAACTTTCGTGAATGCCATGA
CCATAAGCAGCGACTGAGGAATGCAGGCGACCGTGATGACCCAACGCGCGCCAAGACGATAGACGAGGAATGGCAGTACCCACGAATACAGGTATCCGAG
CACGTTGAAGAGCAAGTCTGCGAGACCGCCAGCAACCTGTACGCCATCGTTGTAGTACGATTGGTCCTCCGTACAGTGATTTGGGCCGCAAACGTCCGCC
TCCGTTGAGTTACCACCGAAGACCTCGATACCGAAGAACTGACCCTTGTTGCCGTTGTAGGCAGTGAACCCAAACTGGATGCAGAAGAACACCAAGCAGT
AGATTGCCAGCGTGCGAGGGAGCGATTTCAAGCCGAGGAAAATAGAGGCGAACGCTTCGCCAACCCGCTTCATGGCGCTTGGAGCTTCCTCACCTGGCCC
CAGCTCCAAGTCCTTAGAAACCGgcacctcctccttggcgaaTACGCAAACTGCGCCAACAGAAGCCAGCATGGTCACCGAGAGCATGCCAAGGAACCAA
CGCAGCGTCAGATGAGCTGCACCGAAGATGTAGATGTAGCCGGCCACCCAAATGGAGCCTAGCGTTGAGCTGGCCTGCCCAATACTGGCACCCAAAGTCT
GTCGATCACCAGCAAAGTCTGCGATGATGAGGAAGGCGGGTGTTTGCACCACGTTGACAGTGATATCCATCCACGTGTAAAACAGGATCGTGAGCCAAGC
AGTCCATGGACGATTGTCGCCCGagtcgccaagcagctcccCCAATTCTCGTGTGTATCCCATCAGCATCCAACACGTTGCACTCGTTACAGCTCCGTAG
ATCAAAAacgggcggcggcgtcccCACTTGCACGAACTGCGATCACTCAAGACACCAACTGTCGGCGCCACAAGAATACCGGACAGCGGCCCGATCAGCT
GTGTGAGCTGCACTGCAaacggcggcagcattgTGCCGAGGTACGGACCAAGGGCTGCCCACTGCGCCGACCAAGCCATGTTGGTGGCCATCCGCGGCAG
ggagagcagcacgagcatggCCACGGAGCACCCGGTGGTATGCTTACACTCGCCGGAGTCGTTGAGGTCGAGGTGCGAGAACGTAGACAGTCTTGGAGGA
TGGTCGGGCAGCCCCAACGCCGTTGATTCCCGGTGCGGTGGCGACTCAGCAGGATTGTACGTTGGAGTAGTCACTTCGATGTGCGCGGTCATGGCGTCAA
TAATGCGTGGCGTAGCTCGGTGTACCGGGAATTGATGAAGCTGGCGTGGTCACGAAGTCGGCAGATTCGTAAATGACAGATAGACACTTCTCTCTGGAAT
TGACAACGTGGTTGACATGTtcaagatcgacgagaagTTTAGTCTCTCAAGTACGCCTCAGATGTGCGACCACAGCGGATGCTTACAGACGTGCGGCAGG
ATTCATGCGCACTGATGTTTGTTATCAGATTGTACACACAGAACTTGTCTCCCCTGCTTCATATTCGTAATATTGGTTAGTCCAACCAAGCAAAGGTCCG
ATCTCGCGCCATGCATCGAACGAAGATGTCGCCAACAATCACTGCTGTCTGTCTTCGCTATATTGTCCATCCCTGCGTGGTTCAGGCTGCCAGCAGTGGT
GACCCACCACGGTATTGGCATGGTCAACACCGGGCAGTACATTGTTCCACTCACTGAACGAGAAATACAGTAGATCGTGTTTGCCTGTTGATAAAAGAGC
AGCTATGCCGAGGCGTTAACCGTGCTTGAGCGatcgcgagcttcttgcaTAGCCTGCCGCATGCGTTCCTTAGTCCGCTCTTTCAGGTTCTGGAAGAACG
CGATAtcatcctgcagctcgaccagAGTTTCATGGTTCATCCCATGCACCTGAGCCTCTCGGTACGATTTCCGTAGCTCGTGTAAAatgtccagcacctc
ctttAAATGGTGCGTGTCCCGATCGCGTTGCTCGGCCATCTTTTGCcactcgtgcagcttcatcttggtCTTGCCCAGCCGAATGGACTCCATCAACTGA
TCCGTGACGACCGTTCTACAATTGCCGCACAATTGTCCGTCAGCTGCCGCATTCTGAGTATACGAGTTGGCGATCCCGCTCAGAATCTCCAGGTCCGTCG
TGGGGTTATTAGaagtcgtggtcgtggtcggGGGTTTCCCCAAATTCGGGGCCGGGTACTGCATGggcagcaccgacacgagACTCGGTTGACCTCCGTC
GTAGAATCCCTGCAATTCCGCAACGGGGGTGCTGCCAGTGTccgtctgcgtctgcatgGTCATGGTGGGGAGTTTCCTCTTATTAGTCATATTGGGAATC
ATCTGGCCGTCGGTGTTATTGCAGTCTCCGCCGTTGCTgacgctctcgtcgtcgtcttcctcccCTCGATTGGAATTCATATGGTGCCCATTATTACTGT
TGGGAGGTCCTTGAGTAACGGTGCCGTCGTATTTGCGCAGCAACTCGATGTAGCCCCCTTTATTGTCATTGGCGTTCGGCCCTTTCTTGATGGGGCGGAG
GCCGCGGCGGTAGCACTCGGCGCGCAGGTCGTGGGCGCGGTGCCGCTCGTACGGCTCGTGCAGGCGGCGCGTGGGCTCCTTCcccacgtcggcgtcgttc
gagagcagcgagtcgatgtccccgccgccgctgtgCACGTCCGCGACCAGGGACCCACTGCTTGAGTCCATACGGTATTCTTATTCggcgacgtgcagcg
cggAGGTCAATTCCTCATGTGTACCACATCAACCACCGCCTTTTTTATTTATCTACTAAATAACCGACAAATAAAACAAATAAAACTTCTGCAACGGTGA
GGACGAGCGCTAAATCTGGGGCTGAGGATGAATGGATCGTAGCTGGCTGGGACTAAATGGGGCTCCGCTTCCTTGGTCTGCGGTGTATTTCTGTCgctgg
tcgctgctgctgctgcctctccAGTTGTGCAGCACACTCACGAAAGGGACCGGAGAGCTCCAGTGAGAAGCCATGGACCCAGCGGCGGAGGTGACGCGGC
TGACGGGCGAGGTGcacgccaaggaggaggcgctcaacgcgctcaaggccaagacgaagGCGTTCGTGGACAACATGCGCAGCCAGCTGGCCAACGAGTC
GAAGAAGGTtgcggcgctcgaggagaagctgaaggaggcggctCCCTCAGCTGCAGACAAAGGCTCGGCACTGACgcaggagatcgagaagctgaagcag
gagacggcggcgcgcgagaacgagctcaaggcaCGCGCCAAGTCGTTCGCGGACGCGGTGacggcgcagctggaagccgagaaggacaagagcCGCAgcc
tcgagacgcagctgcagcacaaaaCGGAAGCTCTTGCAGCCGCAAAGGCCGCTGCGGACCAGGCCAAGGAGATGGATTTCCTCTCGCAGCCAGTGCTGGC
CGCTGGCTCGCACACtgacgacgagttcaacgcTCTGCAGTCGCAGTTGAGCTCGGCCAACTTGGACATGGCCGACTTGCGTGAACGCATACGCAGCGTG
GAAACCGATGCCTCGCAGTCCGCTCAGCAGGCTGCGAGTCTGCgtcaggagctggaagcgttGCGTGTTTCatcggagcagcagcgtagCCAGCTGCAAG
TCGAGGTGGACTCGCTGGAGGACCGCGAGAGCGCACTTCAAGGAGAGCTTGACTCGCAACAGACCCAAGTGAAGGCCGAGGGGGATAGTCTGCTTGAAGC
GGACATGGCCAAGTTCAAGGAACTGGAGTTCCAACTGGAGCAACACAAGATTGAGAaccagcacctgcagaagcagctaTCGGACAAGGATTtccagctg
gagcagctAGATGGCTACCGACGGCGCGCGGATGACAGCGAATCCAAGAGACGTCAGCATCAAGCCGAGATTTCCTCGCTTCAGACCCAACTGCAGGCCA
AGTGCGACGAGCAGGCATCGTTTTCGTGTGGCAAATGccccgagctggaggagaaaCTTGCCGAGATTACTCAATTGTATGAGAAGGTCAACCTTGGTAG
AAGCCGCAGTGACAGCTTGATCGCCGAGACGCAGTCGCAGCTGGGAGAGATGCAAaccatcaagcagcagtacgtGGCATCTCAGGAACGTCTCGACGAT
ATGATGAAGCAGAACCTGCAGCTCAACGAGAAGATCTCGGAAAAGGAGATCGAAGTGACGACACTGAAAgcggagatgaagaagtggagCATGGAGATGG
CCGAGCTTCAGTCGCAGCACAGCACACTTAAAACGGATAGCACGGAGCACCGCCAACGCTCCGATTCGGTCCATGCCGATTTCCAGAAGGCAGAGGAGAC
TCTCAAGGATCTGCAAACGAAGTGCGCacagctcgagaagaagaaccaaGAGCTAACGACATCGGTTGAGACCATCAACAAGGAGAACACGGACAAACGc
cagaaggcgaaggcgctCGTGCAGTCGCTGGTCAGTGAGAAGACAGGTTTGCTCGAAGCGAGAAGCGCACTCCAGAAAGAGGTTGATCGACTACGTATGG
AGGTCAACCAGCGCAATGCCGAGAACGATCAGCAGGTGAAGCAATTTCGTGACGAGACGAGCGAAAAGAATTCTCAGAGCGCTGCGACGATCCAAAGTCT
CACGGATGAAGTCGCTCAATTGAAGCGCGCCCTAACTACTGTTCAAGAGTCGGAGAAGGTTCAACAGCGGGCAAAGGAACTCGCTGCAGCTAAGCGCGAG
ATTGAAGACTCGAACAAGAAGCGACTTGCTGCCAAGGCCGAGACGCAaaagctggcggtggagcttGAAAACGTGCACAAGTGCCTTGACCACATTACGA
CGCATGTCAATGCAAACTGCACGGAGAACATCCAGCAGATTGCCCTAGTGCAGGGTCATGTCAAGGAGGCTCTCGAGGTTTTGGAGAAGCGAGCTGGTCT
AGGAGCTCAGGGTAAGCAGAAAACTCCTGAAGACGACACGGCAGAAATCGTTCGTAAGGCGGAGGCACTACGAAGTGGAGGCGCACAGCCGAACCCGGGG
GCAAAGAGACTGGAAGAAAATGTATCGCGCGTCAGCGAACAGGTATGTAGACGAAGCCTTGGACATGCTGTATCCCCACGAACTGTAACTAACTCGCAAT
GTTGATACTCAACAGATTAGGCAGCTTGTGGACATCACGGAACGGTTGTGCGACATCGCGGTGGAGCAGAACGATACCAACCTCAAGGATGTGATCATCA
ACAAGCTGACGCAGACGTTCACGCAATGTTTCTCCGATAAACTTCTGGCCGTCTACTccaaggccgacgaggcTGTGAGTCTGTTAGATGCACACGGACC
GACTTCAGAGAGTGGCCATGCAGCCGTTAGACCCACCGGCTAACCTCAAGACAGCAAGCGGCAAGTTATAAGCCAACACCACTAGTATTTGCATACTTCT
ATGAACAAACATCAATCCACAACCTTCCACAAGCAGTAGTTGCATCCGTTTAACTCGCTTCGTCACTGTCGTTTTCCTCTTCGACGTTCTCTCCATCGAC
TTCTTCAATGGGAGGAGTTCGTCCGCCGGCCGATCCCGTGTCGTCCTTCGAAGAGAAGAGCTGATCAAGCAAGTCCGGGTTAGAACGGCACttctcttcc
agcacctgcatcAAGACATTAGGCTGCCGGGGTCTCTCCACAGCATCCCCAGTTTCCACCGAATTGGCTCCCTCCTGTTCCTTTGCCTCCTCGGGCTCTT
TAGTCTCTTCGCCCTGAATCATTGCCAAGCGCCTTACAATTCCCTTACTGTGTTCGAGAATCTCTTCGTGAGCCGAGAGCACGCTtcggcgctccagcgc
cgcaatCAGAACCTCCCCACTCGCAGCTCCATCccctgcagctggaggatTCTCCATAGCTGTGTACTCCAGCAGtcccaccaccagctcggcaACATCT
TCCCACACAGACGGGAACTTCGCACAtgtctgcagcttcgtcaactCTTCACACACCACAAGTGATAGCAATTGAACCACCACCACATGCGGTCGTAGTG
CTAGCGGGTCTTTCATCGTAGATggtcgacggcggcggccagtGGGTCCATTGGCATCATTGTGTACGTGTGCCTCGTTGGCGCGTTTCAGAGAGCTTTC
GTCGTTAATAGAAGGCAACTGTCGTCGGTAGTACAGGAAGGGTGAATTTGtctcctcttcatcatccCCGAAGTGCATTACTCCGCCGGAATGCTTGGGT
GCAGAACCGTTAAGCAAGTCAAACCCGACAGGGATCAGTCCGTATCGAAGAACATCCAGCCAGGCCATGGGCTTGAACGATTGCTCTGTTCCTGTGTGTT
CACACAGCATGTGCTTCAATCCTTCAATCGCTGCGACAACAAGGTCATTAgacagctcctgcttgatcTGGCTCAACAGCAAGTGCCTCGACACAATAGC
CATCCCGCCCAAAAAGCGCAAGCGCTCTTCAACGTAGTTGGGCGCATCCGGGCGGAGCGTGTCGAACATGAAAAGTAGTAGATCGATTGGTCTCGACGGT
GTCCATGAATCATGTGGGTCGCGAGCCTCCATTGCGAACATGGTCATCTTCGTATAACAGTCGCTAATAAGAATCTCGTTTCCGTCTCCGTTCCAGATTT
TCTCCGTCACGAGTCGCTCAAGAAGTCCGAAGCCATGAGAAGCTGCATGAGCCATTCCGACTGACCAGCTGATCAAATTGCAAATCGTCAGCCAGTCCAT
GCGGGAGTAGTGCAGATTGCTCGGCTGCACTAGCGCCACGTATCGATCCAATCCGCACATAATTGGCGTCAGGAAAGGTCGAATCAGCTCGTCATCCCCG
CTCATTTCCATCAAAGTGCCCAAGAAATTCACCAAAAGCAGCCCATTGGCATCACTATGAGTACGCGTTACCCAAGCAAACAAACCGTTGATCGACTTGT
GCAACAGGAAGCATGCGTTTTCGTATGTCAGTCCACTTGGGCTGTGATTTGTAAGCAGAACTGGGCGCAGAAACTCCAGGATCTGTGTGTAGTGCGCTTC
CAGTATAGCAGATATTCCATCTTCATCATTTGTGCCGCCATCAAAGAGCGATCCACTCAGCGAAATTACTTGACTCAGTAGGTGTTCAAATAGCACACAG
CCTCCTTGGCTGAGCGACAACTTCGTTGACTTTTTCCGGTCTTTTTGAGACTCCTTTTCATCGGGTCctcgcagcaccagcaatgTCTCGTCATGCAGCG
CCTCAATAACTTCGGCCAGAGCGCGTGACGGCAGGCTTGCCACATCCTGCATCAAAAATTCTAGGCGGTAAGGCTGCAACGTGGTTCGGATCCACTGGTC
AGTGCCAAACTCGCCTTTCGGGTCATGTTCACCATCAGAAGGCTGCAACTTTGGTGTTTCCCCCTCGATCACTAGGTCTTCCGTGTGGGAGGCTAGCTCA
GCTGGACTAAGCTGATACTGCTCAAACCCAGGAGAAAGATGGGACTTGGTCGGTGTGGTAGATCCAGGTGCGGAACCACCCAAGTTGGAATCGAGAGCTG
ATAGCAGCCACGCGACACCGCTGAAAAAGCCACCCGCATCTCCATTGCCACCATCCTGTTCTTGGGCACTAAGCGCAATCTTCCTTTCCAGTTCTTCCTT
GTTCTGGTACACCAGGTCAATGAACTCAAGGCGCTCGTCGGAAGTCATAAGCTCCAGTTTAATTTCATCGCTGGGATACATAATCCGAGACGGCAAAACG
TGAAACTCACGCAAACCACTGACGACATGGAAAAAGTACTTCCACGATCGGCTGTGAAGCGCCAAGCTGCATGTGCTGACGAGCTTAAGCACGGCCGCAG
TCGCGACCGGGGCGCTCTGGTTATCACAATACACCCAGATACCATTTTCTCGACTGTTGTATCCCGTCGGGTAAATGTCCGATGAAAGCAGCGACGTATA
CTTGCAAAGGCGGATAAACAGTGAATTGCAAtgctccaccagcgacaAATGAGACGCTACTGCTGCGCATAGCACGAAGCCGTTGCACGCGAGCTGAAGG
GCACTTTTCTGGGGCACGTAGTGCATATCGTAGCTGCTACCGACCGAGAGATCCTCTCCTCGTGCCGCATCCTTTGCTTGAGAATCCACGACAAACTGCT
GGAAGACACTACTGAATGCTCGGACGAGGCTTTGCTGAATCAGCTCAAAGATGTGGCGGTCGTACTGGTTTCCTGAAGAGGCATACAGAGGAGCAAGTCC
ATCGAGCCCATCTTGTTGCTCCAATGTTACGCTTTTGGGTAGGACCGTGGCTCCATTAGCAGGGCTTGAGGCGCTCTTCGTGAGTCGAGCCTGCTGCATC
GTCCGCATCGCATCAGGAGCTAGAGGTGAGGACGTGCCGTGGACAATGCCAATACCACGAGGCGTGCTTGATGAGCGGAGGTGTACCGATGGGTGGTGCA
CAATCAAACGGGAGTTGCGCGGATTGCTTTCTGCCTGGTTGAGCAGGTCCTTCCACCGATCACTCGTCACTTCACCATGCTTGCCACCATCTTCAAATGT
TTTGATCTCGTCCTTCGCAATGGTGTTGTACAACTCCGTCAGGAAGTCCTCAGGCAAATCTAGACCCTTCGAAACTTCCTGGCCGTAGTTCTTGTTGTTC
TTGATAAAGTCGgccagcttcatcttcttgtccGATCGGATATTCGGGTTGTGCAAATCCGTGTTAAGCATAATCAGACTAAACGATAATAGATATGCTA
CGTCCACTGACGCCATGAGAAATCGTTCCCGGCACTGCTCGTACACTTGAAGTGAGAAGGTGTTCAAGATGCGGTCAATTTGCTGAGCCTCTCCTGGTAG
GCGGAAACTTGCGAGGAACATACGCAGTGCAGTGACAATACTCTCGCCTTCAAAATTGCATGACCGCACGAAGTCGGTGAGAACGTCGCGATGGAAGTCC
ATAGTATCGGCTTCGTGGATCTCGGTTTTCTCGAAGCCCTTCACTTCCTTGCCCATCGCACCCAAGTAAACACCCACCGCATTCTTGTTCAGACCTTGAG
GAAGTGATCGCAGGAACGTTGCAAGTGACATGCTGTCGAGTGGAGTAGGCAAAAAGGTGTTTTGCTGCAAGTACTTGATTCCTGCCAAAGGTTTCCGATT
GAACTCCTGAATACCATGCTGGAAGAACTTTTTGCGCTGCCGCTTTTTGAACAGCACTTCTGCCGAGGCAAACTCTTCAGCATCTGCAGGTGAAAATTGC
TCATCCTGTTctaccagcagcgcatcTTCATTCATTTCTTCATCACTCGGGCCATTGCTACTGTCACCACTGACAACAGGCATTTCTGGATGCGTACGAA
GATGCACGACGTACAGTGCATTAAACATTCCACGAAGAGCAATCTCACCAACAGCCTGAGCCCACAGAAAGTGTGTTTCTTCGTGGGACTCAAAGCAAGC
CACATGAGACTGTTGCGCAACCTGTGAAAGCAACTCGAATAAAGTCTGCGTCAAGTCGCAACGGTTGCCGTCGCAATCATAGTTCACATACAGATCCGGC
AACAGCGTAGCCTCCGCGAGCAAGTCCACCAAGCAGTCGAGAATTTCAAATGAGATGTTGTACAGCCGGCTCTTGGATAACATATCTCCGGAGAATTCAT
CGCTAGCGGCGTCGACCATCGTGACAGGTTTCTCGTCCGACTGACCACTTGCGCCACCAGGAGGTGGGGCCGCATCATCTCCACGCGGAAACTCTGGGCT
GTTTACATCCATATTTGCCAGACACCAGTGCAGCGTGTGGTAGAATACGCCATTAAAGAGGGCCTCTACCTGCATCTTAAGCTCCGAGCGGAGCTTGGAC
CACAATAGCCGAATAAGCTTGAGGCAGACCACTGGGATCTTGAGCTCTGCACATGCTCTATACATCAAATGGAACCATGCAACATTAGACCAATGCAACA
AAGCAGTACTCATGCAAAGCTGTACGTACCCCAGTCGGCAGTACCGCAAAATGGCGCTGCACAGGTCGTCCTTGATGAAAAGCATCAGCGATGGCACGCC
CGTCATTAGCTCAGCGTCGCATGCGATCAGCGCACGTTGGAGCAAGCTAAAGGACAGCAAAACTTCACGCCGACTCGTCGTATTCCCGCTCGCTGTGGCA
GGCGCatctggtgctggaggaggcacATAGTTTTTCTGATGCAGCTTCTGGCAGAGAAAGCCCACAATCTTCACTGCACACGGCAGCCCAAAACCCGGTC
TGAGCGGTTCTGATGACGACGTGGCAGGCTCAGCAACCGGAGCCAGGTCCGAATAGATAGCAGCGTTGGAGAAGATAAAGGCCACGGTATCATGCAGGAA
GTTTGTAGCCGTCGATCGCAACGGCAGCGTAATATGCGGCTGTACAAACACACAGCACGTTTATCAGCATCCATCCTCCCATAACCCCCCAACAGTAATG
AACCACGTACGTCGTGTCGATTGCCGCGACTGAGAGCATACAGCGACTCCACCAGCTGCCACATGGAGTGGTCCGACAGGCTGGCACCGCAAGGCGAGCG
CACCACCGCGTGGAGCACgtgcacgaccagcaccagcacgttctGGTCGCTCTCGACGCCCGTCTCCTGGAACCTGCAGTGGCTCACGGCGTCCACAATG
TCCGAcagcgcgtccgccgcccCGTTCTGGTCCTTCACCTCCGCCCAGGGCCACGAGCGCAGGAAGTTCATcaccgcctcgagcgccgcgcctGTCACGG
TACTGCTcgcgtggtcgtggcggaTCACGTCCAGAAAGGGCTTGACGACGTTCACAGGCGACAGCTCCGCCATATCTCCAAAACACGTCGAAAATGGTCG
AAAAAGTGTCAATAAGAGGCCGTTCAGCTGCGTACAAGCACCTGAACTCACTCTCGGACCGCAGCAGACGtccgcgcagcagcgagaagctctgGAGGAC
CGCCAGGGGGCTCTCCTGAAGCCGCAACAGGGAAGTGTTAGCGGTCTGTGGACCTTGTTCGAGACAAGATTACGCAGTCCATAGGGCGCTTGCGCACCTG
GTTCGAGCGCTGGCCGCTCGTCGCGGACAGAAGGAAGccatggcgccgccgcgccagACTCAGCACGCTCTGGatgtcgctcagcagcacggaacgcacc
gccgccatctcggTGAGTGCGCGAACGGGGGGCGCTCTATTAGAGAAGTGACGCCACACCATATCATCCTTGATGTATTGTACATGAAATAGTGTGTTGG
ACACCATAATGCAAGCGCtgagatggctacactttaTTCACGACCAACGAGGTTGCTGTCTCCCTCGTGCACGTGGAAGAGTACAGCGCACGATgcaggt
ggtggcgctcgtgagCGGCGGCAAGGACAGCTGCTACGCCATGATGGAGTGCGTGCGCTTCGGCCACGAGATCGTGTGCCTGGCGCACCTGCACCCGCCG
TCGGAGCTGTcggcggaggacgccgagatcGACTCGTTCATGTTCCAGAGCGTGGGCCACCAGACCGTGGGGCTCATCGCCGAGagcatggagctgccgc
tcgtcTCGGAGACCATCACGGGCACGGCGGTCAAGACGGGCATCGACTACCACGAGTCGGCGGCCGGagacgaggtcgaggacctgttccgcctgctgca
gaacgtcaagcagcagttccCGGACGTGCAGGGCGTCTGCACgggcgccatcttctccagctaCCAGCGCAACCGGGTGGAGAACGTGTGAGTGGCAATG
CATTGTTCGGTTGGGGTGATGAGGTGCTGATGCTTGTTGTGCGTGTTTGTTCCATAGCTGCACGAGGCTGGGACTGACGTCGCTCGGATACCTGTGGCGT
CGCGAGcagaccgagctgctgcaggagatgatCGACTCGGAGGTGGACGCCATTCTGATCAAGGTGGCGTCCATTGGACTGCAGCCGCGGAGGCATTTGG
GGAAGACCATCGCGGAGGTGCAGCCGCAACTCATGACGCTGGTAAGTTTCGGAGTTGGACGCGTGATTTGAAAATTGTGGCGCGTACCCACCGTTTGCTC
AATTTTGGTGGGGTGTGGTGTCTTTGTGCGTTATGCAGAAAGAGAAGTACCAGATGAACGTCtgcggcgaaggcggcgagtACGAGACGTTCACGCTGGA
CTGCCCGctcttcaagaagcgcatcgTCATGTAAGTCTGCTTGTTGCGGTTTTTTTGCTGTTCGATAATCTTACGCATGCGGTGTCCTGTGTTCCGCTGT
TCTTGAAGTGATGAGAGCCACACAGTGATGCATTCGGACGACTACATTGCGCCTgtggccttcttgtcgaTTGACAAGTGCCACCTGGAAGACAAGGAGC
CTGCTGACCCAGCGCACCTGGCCTCAAGGATCCCTGAGGCTTCGCCCTTACAACCCGCAAGCAACGAAAAGACCATGAACAAGAAACCGGCCACCGTGCT
CGCCCTCACCCCGCATACAGCAACAGATTTTATACCTGCCTTCGGTCAGTTCCGCGACCAATTGCACCTGTCGGGCATCATGAGCAGCAAGGCTGGTGAC
GCTTCAATcacgctggaagaagaagtagCAGATGTCGTTGCTCAGGTAGAGGCTATCCTCGAGAGCCAAAAGATGGTGCTAGCCGATGTGTGCTTCGTGC
ACCTGTACGTTCAGGATATGTCCGCCTTCGGGCAGCTCAACGCCGAGTACATCCGGTACCTCGGCCAAGACTTGCCTCCATCCcggagctgcgtcgaagT
GAAGGCATTGGCTGATGTTCCCGCCCGTGTGCTTCTGGACTGTTTCGCGTTGCGTGGCAGTGGCGAACAAAAGTTACAATCCCTGCGTGTGCGTCGCGAC
GTTTTGCATGTGAAGAGTATCTCGGCTtgggcgccgtgctgcatTGGTCCATACAGCCAAGCGAATGTGCTCCACCGAGCGCTCATTCTGTTGGCCGGAC
AAATCGCTCTACACCCTCAGACGATGGATCTGGTGCCAGGTGACCGTGCTGCTCAGACGACACAGTGCTTTCGGAATGTCTGTCGCGTCCTGGAAGCGCT
TCAGTCCAACCTGCGTCACGTGTGCTCTGGTGTCATCTACACCACCGGGGATCCCAACGACCGTGAGGCTCGCGAGCGCCTGCTAGTCGACTGCCGCCGA
CAGCTCTTCACAAACGCCGAGTTGGTCGATGAGTTCGAGGATTCTGATGACAGtgacgagagcgacgaagaagttgacaAGAATGAAGCCCGCGTGGAGT
TCGTGAAGGAGGTTCCGCTGCTGGTCGTTCAGGTGTCACGTTTACCGCGTAACGCCCTagtggaggtggagctccaGGCACTCACGCACATCGCGCTCAA
GTACTTGGTACCACGCAGTCTCACGCGCACACGTACTTCAAACAACCTGCGTTTCGACTGGCAGAGCGGCACGGTTCCGCGAGCGCTTTGCCAGATCATG
TGCACTGCATCACTtgaagaggatgaagaaTGCTTAGACACGCGAGCGTTGGCGAAGGTTGTCGCTGAGGGAATCTGGACCTGCGTGCTGGACAGCCTGG
TGCAAGCGCTGATGACTTGGGACCGCGTGATTCATGTGCGCATGTTCTACGTGGCAACAGCATTCTCAAGCGAAGTGGAACTGGCCAAGGCGTGCCACGA
GTCTGTTGCATCACAAGGAAAGATAAGCAGCATGCCGGGCATGACATTTATTCCTGTGGACGCAATCCAGGGTGATGCCGtagtggcgctgcaggtgacg
GCCCAAGACCTGGATAAGCTGGAGACCGAGCTCTGGCTGCACAAGCAGATCTAGATGCTTTCCATAACCGCTGTATCGATGTTAGCGAGCGCAGTCAGAA
TCCGAAAAGATAATTCACCAAGGTGTCACGCAACTCCTTATTTGTTTTGTTAGATGATTGATTTCTTGGTTGGCGGGCTGTACTCGGTAAGGATGAGCGC
TGTAGTCGCTTGCCTGCTTGCTTTTTGTCGTCTAATGCCGCCGTTTGTGACGCTGGTCACCGGGGCCTCGGCTACCGCCAGCGCTTTCGTCCCTACCCTT
GCGCTTGCGAGAATCACGGTCTCGGGACCGGGAGCGTCCGCCTCGATCCCCTCGGCTGCGACCTCCTCGTTCTCTCTCCTgctctcctgctccgccGGCA
CCACGACCCCCGCGCTCTCGAGGACGTCCTCTTTCACGACCGCGATCACGGTCCCGCCCACTCTCACGGTCCTTCTCGTTGGCGGCATCTTTCCCGCCAA
CATCGTCTCGGCGTCCATTCCCTCGCGAGTCATCGCGTCGAGGGCGATCGCGGGATCTCGAACGGTTGTGACTTGCCTCTCTTGATCGGCCACCACGTCT
ATCCTCGCGGCCTCGGTCCTTCTCACTGGCATCATTTCCTCCAGGACCGTCTTGGCGTCCGCTTCCTCGCGAGTCGTCGCGACGGGGGCGATCACGAGAT
CTTGATCGATCGCGACTTGCTTCTCTTGACCTACCACCGCGTCTATCATCGCGGTCATCCTTGCCGCGACCCCGATCGTCAAAGCCGCCCCtgcctccac
ctcggcctCTGCCACCACCAGGTCCGCCCATCCAAGGAGGACCTCTCCCTGGTCCAGAGCCCCACGGCGCGCCGCCCATAGGAGGACCGTTCCAGTTCTG
CTGACCCATGAAGCCCGGTGGCGGGCCCATTCCAGGGTGCCAGCCCCGCGGAGGTGGGCCTCCCATAAAGCCACCTGGCCCTCCTCGAGGCGGAGCGCCG
CTCATCGGCGGCAAGCCATTTCCGCCAGCACCCCACTCTCCAGGCCGCCCTCCACTCGGCtcgtctccaccttcttgcttCAGCTGCCCGGGGAAGCCTC
GCGGGGGCATTCCGCccgctcctcgtccttgcaTCTTGGCGTCCCGGTCTCTcatcgcttgctgctggttggccGCATTCACCGCCTGCCTCGACGCCTG
CTCTCTCGACTTCTCCACTGCCAAGTCGCGCCTCAGCCTCAGCTGCCGAGCCGCGTACTCTCTCCAGCTGTGCTCATCAAACCCGTAGTTGAAGTAGTCC
GAGATATCCACGCCGGGTTTGCGCCACGGCCtgtcctccagcaggtcgatgtccacgtcgaagGCTGTGCGTCGTCCTCCAAACATGGCCATATCGTCCA
GCCCATCCGACGCGGAGGCCCCCGAATCCCCCGGCTGCGAGCCCGTCACCGCCCCAGCACCAGGAGCGCCAGGCCCGCCGTGTTGCGGACCCCCAAAGCT
GCCGCGCACGTAGCGATTGCCGCCGCCCGTGAAGCGCAGCGTGGGTTTGCTGCCCGGGCCGTGGTCATTGCTCAGGACGATGgccacgtcttcgtcgtcc
tcgtcctcgtccgagtccgccGCCGGGTCGTCACCGGCCTTAGAGccagctgctcctccgttgacagcagcagcggaggccgccgccgccgcttccgccT
GCGACGTGGCGGACGCGTTGAGCTTGATGGAGACGCCGCCGtagagctcctcgtcctcgtccgccgcgtccttgtcctccttcttctcgggcTTCACGGC
GGGCCCATCGTTGGCCTCCCACGTGGCTCTGGACTCCTCGGTCTTGGCTTCTTCCttgacgctggcgccgcccgcgcgcGTCGTCACCAGCACATCCTCG
CCAaactcctcgtcctccatggTGTCGGATCACTACACTGTACCGGTAGTAGCAATAATGGGAGGAGTGGTGTGCGCAACATAATTATTTGCCCCGATTA
AGTCCGAACCCACGACGGGTCGGGTTGGCTTACCCGGGTTCGGACTTTGGCGGAGTGTTAGAGTAGGTGCCATCTTGCCGGTGATTGGCTCGCGAGCTCG
TacacttggcgtttgtatgctGGCGCCTCCGCGGCCAATAGTTTCGCGGCCCGAGCCACGCCCCAAGCCTCGCCGACTCACGCAGTTCTTCTTGTCTCGT
TCGACTTTTGCAGGTAAGCGAGGCGTCTTGGCTGACGATGAATGGGGCGGCGCCTTGTGGGGGGAAGCGGCATGTGGAGCGATATACAGTGGGGGGCTCA
GATACGCCAATCAAAACGGCGCAACTGCAAGCGCTGGGGCGTAGCAAATGACGGAGATACAGGCCAACGACTGGAGAGAATTATAGCAGACGGAGAACGC
CTCGTCCCGACGAGATGACGCTGTTCCCAGTGCATTCCCCACTGCCCATCGTGTCCGCAGTGCGCCCCTCTACACGACGCAGGCCTCGGACCTTCCTGAC
GACGCCCGGACGAGCAGCTACTAACGGGTTTGTGGTGTTGATACATGCTGCAGGTTTAGTCAAAGATGCCGCACTCCTTCGGTTACCGCGCGCGCACGCG
CGACATGTTCGCCCGCCCGTTCCGTCAGAGCGGCATGATCAAGATGTCGACGTACCTGCGCACGTTCAAGGTGGGCGACTACGTGGACATCAAGGCCAAC
GGCGCCGTGCAAAAAGGCATGCCCCACAAGTACTACCACGGCCGCACCGGCCGCGTGTACAACGTGACCAAGCGTGCCGTCGGCGTGCGTGTGAACAAGG
TGGTGGGCAACCGCATCATCCACAAGCACATCAACGTGCGCATCGAGCACGTGCACCAGTCCAAGTGCCGTCTTGGCTTCCTCACGCGCGtcaaggagaa
cgagctgaagaagaaagaggcCCGCGCCACTGGCGTCCGTGCCCAGATCAAGCGCACCCCCGTGCAGCCCAAGGCCGCCTACACCCTGAAGGCCAAGGGC
ACCAAGCCCATCACCATGGCGGCGCAACCGTTCGTGGACCTCATGTAAGTGGCTCTCGGTGCACTTGGCGCTATTGCTACGAACGCACTGTTGGGACCTA
GCGCTCGGCTTGTGGTGCGGCTCTCGCAGTCGCTCCCAGGCACGTCGTAACCCCAACGAGCTGGGCTAAATGAAAGAACGAGTCAAATCCACGGCGTTCT
CCGCTTTTGTCCTCTTCCTTGGCTTGCAATTTTCTGCCATCGCGTCAGCTCT