Description :
From Genome Similarity Track
Location :
scaffold_253:842- 7056
Transcript NameFunction/comments
g6351.t1 protein kinase
g6352.t1 conserved hypothetical protein
g6353.t1 hypothetical protein PHYSODRAFT_353505

Sequence
6214 bases(100 bases per row)
TGACACGTCCGCACATACTCCATCCGTCCCCACCAGTGTAAACGCATCCGACTCATGGAGCGGGACTATCATATCAGACGTTGACTCTTGTGCCACCGTG
TCGTCGGTGACAATCGCCTTGAAGGTAATATCCGCGCCAATGTCCGATGAAGGGATGTTGGAGCAGCTCAAATATCCGCTTGACTGCGCTGTATCAAACC
GCTTGCAAAAGCGGCAGATGCTGTCCACACAACCGACGCCTCCGTCTCCGCATCGGAGATCGGAGACGATGTCCAGGCCAACACCTTTGTCTCCACCGGA
TACTGTCCTGTAGCATTCCAATGGGATCGCGTAGGTAGAGACTGAGGAAGTCGTCGGGGAAGTCGTCGGGGATGTCGTCGGGAATGTCGTCGGGGAAGTC
GTCGGGGATGTCGTCGGGGATGTCGTCGGGGAAGTCGTCGGGGCAGACGTAGGAGCAGATGTAGGTGCAGGCGTAGTTGACGACGAGCTTCCGATTGAGG
CACAGTCCAAATACGTGACTGACTGTGCCGTTGTGGTCGTTCGGCAAAAACGACAAATACTGTCGATGCACCCCAAGCCCCCTTGAGCGCAGGACATGTC
CGTGACGATGTTGATGCCCACTGCCGCATCACCTGCAGATACGGTTGTTGCACACGTCTTCGAGGCTTCAGGACACGCATTCAAATGCGCGGATAGTGTC
GTGCTCTTGGTTCTACAGTAACGACAAATGCTGTCGATGCAACCAACGCCACCACCGGCACAGGTCCCGTCCGTTGTTATGCTGATTCCAACCGCAACAT
CTCCATCCGAAGCGGTTTGAGTGCACGCACTAGCAGATACCCCACGCATCAAAGACGATTTTTTGGGGACCCAGAAGCTTGAGGGCCAGCGATTCCGTTG
GGTCTTGAGCGATCGTGGGTATTCGCAATATGAAGTCGTGCCAGTCTATCGACTTCCTCCATGGGAAGAAGGAGCGATGAAACACCTTTGCTTCCTTGGG
CATGTTTGATCGCATACTTCTCGTCCCAACAGCAGAAAAATAGAGTTGCTGCACCAAGGCGCATCGCTCTTGAAACGGACGTACTAAAGTCGCTTACGCT
TGAGTCAAACCCCGCTGAAGAACAAGCTGGGAGTAATTCCGCATGAGAAGATACATAGCGGCTATGTCATAGCCACTTCAACTTGAGATCGAAATCAAAA
ACGAAAGCAATAGGGTTTACCGGTTCGCAACTTACATGTAAATGTAAACACTAAATTATGCCTGAAGTAAGCCCGTAGTTCTTCTTGGCCGACGGCGTCT
TCGGTCTCGATGAGATATGGCGCTGCACTGCTGTCGCCTCCGAGAAACTTTTCGAAAGATCAATAGCCAAGCCTAACGGTACGACATTCTTTGCCTCTTC
AATGAGGAAAATGACTGTGCTGAAGGATGGCCGCTGCATGGGTTCAGGGTCCCAGCACGCCTTCATTATCCTGTGAAGAATTTCGGGAATGTGTGGTAAT
AGCTCCGGGCGAAGATCCTCGTGTGCAACAAGATAAGCCAGGTTGATCGCATCTTTATCGAGATAAGGCTTCTTGAAGCAAAAGAGTTCCCTGCACGCAG
CTATCGGTTAGAACAAGGAGATCTTCCGACAGGAGTGAAGAGATTGCCTACCAAAGTACGATACCGTACGAGTACACGTCAATCTTTTCCGAATAGTCTT
CACCTCGGAAAACTTCCGGTGCTAACCACCGCGGCGTGCCACACATCGTATGCGCGTTGGTGTTCTTGTCGAGGCTGCGTGACAGTCCGAAATCGCTGAG
TTTACAACGAAAGTCTTCTGTGATCAATAAATTCTCTCCCTTCGAAAACAAGAAAGTGGGTCAGCTATCATTTCATGGAGAGTAACTTCAGGGAGTCTTA
CCTTGATATCGCGGTGGAGCACAGCTGGGCTTAGCGCGTGGAGGTAAGCACAGGCTTTTGCGCAGTCCAGGGCGATCTCGAGTGTGAGACCCCATGTAAT
ATTCAGTTGTTGACTACGTGCGAGTTGCAATAGGTCAGCTAGAGACCCGGCGCAGAGTTCAGTTAAAAGACACAGCGTTGGTGGCTCGAGTACGGCGCCA
AGGAACATAACGATATTAGGATGCTGCAAGATGGAGAGGATGGACAGCTCATTCTTGAAATCTTGAACAGTCTTCGCCGAGTATCTTTGAGCAAGTAGCC
GCTTGAGCGCAATGTGCTTTCCCTTGAAGAACGCTTTGTAGACCACGCCAAAGGTGCCAGTGCCAATTTGACTCTCGATCTCAATGTCTTCGAACGGAAC
CTTGAGCCCAAAGAAGATCGAGTTGTCTAGTCGTCTTGAATCTGTGATCGGGTTCACGCGATGTTTCTTCTTGGATAAAGCCACGTAAACGAGAGTACCA
GCTTGTGTTGTCGACTGGAAGTGGTGGGTTAGTGGTGACACCGTCACAGGCTCGCGTGAGAACATGCTACCCATCGGTTCTACCCGTGGAAATACAGAGG
CGGGAAACTAGATCCAAAGGCTAAGACTCGAGGGCGAGTGAAGGCGAGCACATGTTGGGCATGGTGCACGGTCTATTTATATCCGTCCTCCGACAACTAT
AAATCATTGTATCATACGGATAAACGCTTTCAGAGAAAAAAAGTAGCCATCGAGTTCTTCGTTAAACTCAAAGAGTCAATTGTGCGATTCTTCGAGATTA
CAGATTTATCAGTGTAGGAGCCTCCCACTTGGAGGTACTTCGTAAACAGGAGGTTTAAAAAGGTGTTTGAGTAGATTCCGACAATTTCAAGTGACCCTTG
ACAAGTCAGGCACAGTGAATCTTCTTGAAAATATGTAGCCATCGACTTCACCTGTAGAACTCCTACTCAAACAATACATTTTTTGAATTGTAAGCCTTAC
ATGTACGACGCTTACTGCTCATGTAACAAACGACGCTTATACGTAGGAAAGGCTCACCAAAGTGCACCTTCGTGGTGGTTACTGTACACCACGATAAAAA
TACCACAAAGAGTTGAGTGTTGTCCTTGAGATGTACATGCTCGTTACGATCGTCAAGCTCAGAATAATATTTAGGTGCTGAAGCGGTCGGACTGCAAACT
TTGGAGTACATGTACATGTAAACGCCGAATGCACTGGCAAGCTATATAGCAACCAAACGACATCCCAATGCTACGCTTCGCGTGGTGATGACGACCGATG
CGCGGCATCTTGTTTTTCGAGAAGGTCGAATCTTGGCTTGCTTGCCGGTTGTGCGATCGAGACTTGGATTCACTATTGCCTTCGTCTTGCCAGAATCTCC
GAATCTCGATGCTCTTTCTTTATCATTTGTTTTACATACACCAAACCTCTAGAATTTCCAAAAAGAGCTCAGTTTTAAAGTGTTTGCATGGACTCAATAT
GTTGTGCTACCAAAGATTTGTACCTTGTTCTGTCATAAGTTGAATTACACCTCTAGTTTTGCACTTCCAGCATTTGTAAAATTCATTCGCGGGTCTGGCT
TTTTGAATCTCCGGAAATGGGCACATTGAAGGCGGAAGTTTGTATTGACACCTTTTGGAAGTGACCATACATTAGCATCGGGCCATCCAGAATCTTACCC
GTCCCTCTGTCCACAGCTCATCACTTCCCATTCGCTGCGCTGCAGGGCATTCCGCTCGACAACTCGTTATGAAATTCGGCAAAGGCCTGCTGCAGGAGAT
TCTGCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAACTACAAAATACTCAAGAAACGCATTAAGGCTGTGACTCGCGCGGCACACCACGCCGCCAAC
CAGCGCGACATATGTACGTGGTCTTAGCTATTTCGTTTTTGCAATGGTGCCCCCGCTTATCGTATAGCGTATTTTCTCCTCGACAGCCGAGTCGCAACTA
GAGGTGGCCTTCTTCCGAGACCTGCAGGCTGAGCTCAAGAAAATCTCTCTCTTTTATGTAGCCGAAGAGAAGCGCTGCTCCTTCCGTTATCACCAGTTGC
GCTCTGTTCTCAAGCATCTCAAGGTTTGTCTGGGTATCCGACCCTTTTGCTACATTGACAATCAGTCTAACCGTTGGTTGTCTGCAGAAACGAGAGAAGA
TCGAGGCGTCTGAAGCGCAGCGACTGATGTTCGCCTTCGTGCACTTCTACCGCGAGTGTATCCGCCTAGAGAACTTCGCTGTCATGAACTACCAGGGCTT
TTCCAAGGTCGGCATGAGATGTATTCAGGAATTGTTGACCCAGTGACTAAACTTTTTTTCATGGTCGAAATCAGATTTTGAAGAAACACGACAAAATGAC
GGGATACAACACGCGGTCCAAGTACATGCGCCGCAAAGTCAACTTGTCAACCTTCTCAAGCTATCCGGCTCTGCTGCGAATTCTGTCCAGCACCGAGGAC
ATGTTCCATGAAGTGGAGCGCGACGTCCGCATGGCTTCTGCCGTGTCCAACATGAAGCTCGACATTGAGCCGCAGAAGACAACCAGCCCCAGCAGCGCCC
ATGTGCTAGCCCCAGTGGTCCATATCCCAACAGGAGATTCGTCCACGCCCGTGCACACGGCCGCTTTCCCTCCCAAGTTTCCCTCCCCCCACCTCACGCC
GTCCAACTCTTCTACGGTCGCTGCTTCGTTCCCAGCTTCAGTGCTTTGGACAGCAGAAGACCAGGCTGCGGCCTATAAGGACTCGGAGCAGAAATTCCAG
CTCTAGTTGGTGATACCAGTGCCTCGTATCAATGTCTAATTTATCTGCAGCTATAGGAATGAGTTCAACTTCACAGGTTGGGCAGGCAAAAGTTCGTTCT
AAACCTACACTTTCAAATTTCAACATACATACTTCATTATGATTGGCCCATATATTGACAATAAACACTTGACCCCCTCACTTTCACTCTTTATCGACAC
TATGGCGCAGCTACTCCGCGCCGCCGGTATGCACTGCCCCAGCCTTATGATTCCGTTCGTACTGTCGTTAACTTGTCAACTACATGTCAGGCAATGGAAA
CCTCGAGAAGGTGATCGATCTACGCAACGACTGGGGCTATCAGAACAAGAAGGGCGAGTCTGGTACGGCATTCCCATGTCCAAGATACAATTTTTCCAGT
ATATTAAGCTACTGCTGCCTTTACTGTAGTGCTGCATATCGCGGTAGCCGAAGATCAACTGGAGATCGTCCAGCACCTCGTGTCCAATGGGGCTATGCTC
AATTTGCAGGAGAAGAAGCGCCGCTTCACGCCGCTGATGCTGGCACTGGCGCAGCAACCCCCGAGCTTTGAAGAGATCTTCCAGGCCCTGCTCAAGGGAA
AGCCCGACTTGAGTGTGCAGGACTCGTCGGGCCAGACGGTGCTGCATCTGGCTGCTGAGTATGAGGAGGTGGAATCGCTAAAGCTGCTTCTGAGAGCCAA
AGCCAAGGTGGACGCAGTCGACAACAAGAAGATGACGGCGCTCCACGTCGCAGTTGGCAAGGGAAACCTCGAGATTGCCCAGTTGCTGATCGAGACGGGT
CGAGCCAACGTAAACGCGGTAGATTCCAAGGGCAACACTCCTCTGTATGCTTGTTCTTTAGTTTCCGTTGTGAAGTTGATACTAAATCATGGTTGCACCT
GTAGGCACTGGGCGTGTATCAAGAACGGCGATGATCAACTTGAGCTTATCAGCTGTTTGATCTCCAAGGTTCGTTATGTGCTGGGAGGAATTTGGATGTC
ATATTAAACAATGATGCTTGTAGGGAGCAAAACCTCTCAAGAATGGTCATGGGAACACTCCGTTGCATTCGGAAGCGATGCACTGTGATCCAACGGCCAA
CTGGCCAACTGCAGCTGCGGAGGCGCTGACAACTGCGTTTCCAGACTTGATAACCGAGGTGAGCAACAATGGTTTGACCGCTCAGCAGACCTTTGAGCAG
GATATCGATGCGGAAGAACCAGTAGAGAAGTCGCCAGTCAAGTCCTCAAAGAAGGGCGGCCGTCGCGGCAAGGGCGAGGATGATGAAACGTACCAAGACA
ATTCTGCTGCAGCGCGAGCTGGTACGTTTACAAACTGGTTGCTTATTCAATTTTCCTGCGCGTCTAACATGCGCATGAACTCGTCACAGCCGCTATTGCT
CACTCGAAGAAAAAAGTTTCCAAGAGTAGCAAGGAGGGTGGTGGTATGGCTCCCTACATGTGGATTGCCTTGGTGTTTGCCATTCTCGCTGTCTTGAATG
CCTTGTTTTCATCG