Description :
From Genome Similarity Track
Location :
Scaffold_225:8419- 14542
Sequence
6123 bases(100 bases per row)
AGAGTTGATATATCGACATGAATTGGTCCGTAATTTTGATTGTCACTGACTGTCGCGGACGCGGAGACGGCATGACAAAATTAGTAAGTGATATAGCACA
CCGGAGGATCCGATGGACGACCTCAGTCAGCAGATGGTTGGCAAAGGTCTTAGCTGATTCGCTACTCATTTAATCGACGAGTCTGTCAGCCAATCGAAAT
GCAAAGTTACTGGTACATTATCGGTTGATGGAAGGTACCACATGGGCAGGTCTAAACATCATCCTTTGATAGACTACATCTCCTCTCTTGAATCCTCCAG
TACAAAAGTTTACATAACTAGTGCTTTTAAGTCATGCTCTACGATACTATCATCGTCCATACACAAAATTATTGGATGTGTGAGGCATTCATTATGCGTC
ATAATTCACCTCTAATCACTCCTCATTTTGCCCGATTGAAGGCAGTCGATTAGAAGCAAAGATAACTAAGTGCGAACCGAACTTAATACGTCTCGGTCTA
ACTTCGTACCATGAGGGATCCGGACACTAGGTTCGGGGGGCCTCCACCAGGGGGCACGGCTCTGGACGGAAACACTGCGTAGCCGGGAAAGGGTGGACTA
TGCGCCATCCAGATGCCTACAAGGCCTGCAGTTGGTTCTGTCATCATGAAGCTGCCGCGTACAAGGGAGATGGAAGGGACGGGGGTGGACGGGACATCTG
CTCCTCAGCGAGCGGGCTGTGCAGTCGATAGCAACCATTATCTCTGGCAGGCGGCTCGTTGATGTTGGCGTCGAGATGAAGGAGGAAAAGGGGTCATCGG
AAAACACTACTATCGCCTTTGAGGCTATGGGATCAGGACCATTATGCTCGGAAGAGTCTTACTCAAGTCTCGTTTAAGACATGAAGGAAGCCCAGCTTAT
AGGACTGCGGGAGGCATGGCAAGATACGAAGGCACACCTATTCGCCGCGGTTTATAATTCGATAACAGCCAAAAGGTAGCAGATTGCAGTACTGAAGGCT
TGGTATCCTTCACTGCATAAAGCGGAGCGAGGAATGCTAGCAACATTTTCGAGGAGGCATACGTAAAAGTGACCTGTACTTTTAAGCAATGGAAATAACA
TGCGACAGTAACCAGTAATGACATCCAGAATACAGCGTGGATGCTGACAACTGTCTTGGATCGTATGACGAACAAGCAGCGCTGGTCGCAGTTACCAGTC
ATGAATCATCAGCCGGCTAAAATCAAGGGACCTTTTCACCAAGCCAGGGCAAAAGTAATTTAGAGTCTGGGTGACAGCATGAACAATATATGTTTAATCC
GGAGAGGTACACTCAGAAAATGCAGCCGGTTGAGCGCACTCACTGTGCGGTCGCGGTATTGGGGATAATAGGGAGCTTAGAGGAGGCTTGTGGACAAGTG
GCGAATTATTCAAGGGCTGGCAGAAGGAGATATAGTGGGAAGGAGACTATTACCATTTCTCAAAGCAATTTTATTTCTCAGGAAAAACTTCGGCTGCACA
GTACAATTCCAGCTCAAGTTGAAGGGAAACTCAGCTTTAATTAAGCGGTAGAGGCACAATTTCATCGAGTCGGCTACGCAGGCAGGTCCTTAAAGAAAAC
ATACTGTTGGCAGCGAAGTATGCTCGGGTGAACCGCAACGACCTTTACGATTTTCATTGTACCCTCAAGAAGATCAGCTACAACCATGCTTCGAAGTCGA
TTCATCTGTTCTTTGTCCACCGTGCCACGGCAACAAAAATTCAATACACGACGGCTCGGTTCACGCGAGTGGAGTACCACTTGAATACCAAGCATTTCCC
TTCTTCGGGCTCAGCCTGGGAGAGACAGCAAGGATCAGTGAATTTCTAGACTCTTCGAAAACTGGAGTACGAGATATACCTATACAATATTTCGAGGTTC
GTCGATATTGGGAAGATATCAGCGTTTATCAGTAAGCACAGTCCTGTGAAGCATGATCTCGAAGACATGGGTTGTTGTACACCACTGTCTGGAAGTGAAC
TTACTTGCTTGCTGGGTGTTCGCAATCTCTACAGAGGATTGTACGCTGGAATTGGTTTGGAACCACCATCATTTTAAAGCATCCAGTGGTTGGTCTCCCG
CTACAGCGCTACAAATGTGGTAAAATCGGCCACATGTCGGCATGATGTGGCTACACAGATGATCAACTGAAAGGCAGTGGATGTTTTAATAGCCACTGAA
CAGGAGTTTGTGGCACTTGATGATGCCGCCAAGACTTTTGCTAACATGGAGGATATGGATGTTGCAGCCTCTTCAACATGACACAGCGTCTGTCCGGAAC
CGTACGATTCAACCCCATCCCACGTCGGAGAACAGAATCCAATCGGGTCTGTCCGGCGAGATGATCAATTCCAATCACCCAAGTACAACGGTATTTACGC
AATACGACCGACCCACACAAGAACGATCTCACGACTCTACCCACCCGAAAGAGAACTTAATGGATTAAGGTACCGTTGCGTGGTAAACGTCGTCTATTTG
CAGCCAAGATTTCGCTAGCACAGCAGCCCGAAGGACGACCTACACAATATGACGTTCGATCAGGAGACGATAGTTTTGCCTTGGATGGTAACGAACCCAC
ACCACCAGACAATAAGGATCATGTGGTGGAACCTATAGACATATCGCCGACAGAGGAGACCGCAGACCAGACAGCCAATAACGCCAAGGACCCGGCCCAA
ATTCGTATATCAAGGAAGAATCCTCCTCCTATACCAGCTACCTTTGATCTGATCGGTCTTAGTCAGCAAGAGCGGACCTAGTTACAGAATCTCACTGCAT
CGGAGGAAGTCGAAAGTCACTCACGCATCCCGGTTGCTAACCACATGGACATCTTTATGCGGTCTGAGGATGTCATAACTTCCCAGCTTGGGCTTTGGAA
AGTCACTAAGCCGGCAACGCGAAATCGCATTGGCTATAGACATTATTTAAGCTTTATTAAATACTGACCTTGGAGCTCAAGACACCTTGTTGACATCTGC
GATTATTCGCCTTAAACGGGGTATTACGTATACCGGCCAACTGCCCGTCTAGGAGAACGATTTTAACACGGAAACTCGAGTCTCTACACCCATAGCAGTT
CAAAGAGGTGATTTGGGGATATGAGTGGTTTCTGCAAAGAGGCAATCAAATTGGTACCTGGAGGAATACGATCAAAGACCTTCCGATCGGAATGCGAACG
TTACCATTCACGATTGGGGTGGATGTGAAATTCTTTGTATGGAGGCGAAGTTTCTCCGACGAAATATCTATTTTATTGCTAACGAAGGCAAAGGCAATGG
GGCTTGGTGATGCAGTCTCTACTGAACGAGTTACATCACTCAAAATAACAGTATTATATTATAACAGGAGAAAAACTGGTACTAACGGTCAAGTAATGAT
ATCAAGAAATTGCGCAGGACAATCACACCATGACACAACCAGCACCCCTTGTACTGCGATAAACGGGACATCATTATTCAGCGTATGTTCACTAGCGAGA
AGTAACGCCCCGCGTCTCTGTTGAGCTATGAAATGGGCCAGGCACTCTGGCCCCAAACGAGTCATCATTATTGTCAGACGTATTCATGGGTTAAGCTCCA
GATGATGAATCGGTTGATGACCATGATGATAACGTTGATGCCCCAGACGTGAACATGATTAGCAAAGATTACAATGACCTGGACTGAAGCATTGAAGACC
GGACTCACGGACAAAATACATGATCAATAACGTGAGCTCTACATTCCCGTTCGGCTACAATTTATCACCAACCAGATATTTAGCACCTCGGAACCGAAAC
AATTCAATTAATTTACTACTTTTTCTCACATCGAAGGTACCGCGGCTAGCGAGTGTTGACCAGTACAGATTAGAGAACGCATACATGACCAATGCCGCCG
ATCTCGCAATCATTCAGCCTTAAAAGCAACACACGTTATCTTCCTGCATATTACAACAGTGGAGCACTCTGCTTCAGGGGGACGTACCGGGGGATCAGGA
TGAAAAACCCTCCAGGCCTTAGGTCTGGCCGTCAATTCTACTACCTTACCGGTGGACGAGATAACAGCCTTTTCTTTCACACGGAGAACAGGGAACAGGG
GACCGAAATTCGTACCCAGCTGGTTGTCCACACTACGTGCAACCTCTCTCACCCAGTTCCGATCATACAAAACCAACTAGCAACAAGTAGCAAAGGTAAA
GAGCACAATACAAAACTTAGTCACAAGAATTACACACTAGCGCCCAAGGCTTGTCGGGTCAGCATCAATTGGTGGTGCATTGATGAAACACGACATTCTA
TTACTTACTAACGGGTTATGGCAGAACATGTGGCTTTCATTTAGCGCGACGTGGATGACGCAATCTCGAGTTGACTTTCCGACGCTCCAGAGCAGCACTT
ATCACTGATAGCGTGCGGTGCACGCAGAACCGGTTCAGTTGATGCTACCGATACAAGAATTTCCGTCTTAGCATGCGCTTTTGAATGCACTCAGCGATGG
GGTTTTAGTGACGTGGACGTCTGCTTGGCGACGAGAATGCCTGTATCAAGACCTCATGCAATATCGCAGGCGAGTATCCGACAGTTTGACGCGCACATGG
TTGGTGGCTTGGACAGTCCAAAGAAGTCGTTCGATTTCTGGACAGCTATTTTTGCCGCTTATTGATAATCAAAATGATTGGAACAAACTACGGGGTATGA
AGTATAGCAATGACAAGCTATTACGTCAATGTGCGCCTTATTATACGACGCTGACATCAATGCCCTGACCGTCAGCCCAAAAGTGGTCAACGGGGAAATA
CCGGATTGCATACGTCGACATTTAGCAGTATTTCATGCGAAGGAGGATTACCGTCGAGCTTTTAGGGACACATATGTTAAAAAATATCTAGCTTGATCGC
CAAGCTTACCTTACAACAGCGTTATCCCGTGAGTCCGTACCACGGACACTTCATTGCTAAGGGCTTCGAAATTGGAACCCTGCACCAAGTGTCGTCAACG
TCGGAGATTGGATGCGATGCTGATACAATGCAACGGGCCGTCCAAACTCTTTTACCCGCGACGATGATTTGATCCCGCAGCAGGTGTAAAGACGGGGGGC
TCACTTTTGCTATTCCCAAAACGTCAGGGAGGTCAAGAGCAGACCATCTTAGATGGATGAACGGATGGACGATGCGTGGAACACGCTGTGATGCTAAGAT
GTGGGGATTCAGGAGACATAAATAAATTCCGATCGTGTAGACCAGAAAGCAGCGACATAATGGGATTATGTTTAGGGCACACAGCACAATTAACAAAATG
GGGAGTCTTCCTACTGGATCGTAAACACTGACAAAACTGGAGCAGCAATAGCGGTGGAACCCAGAAAGCAGCGCGTCCATTAGCGATGGACTCCGGAATT
TTGGTTCAAAGGATTCGTTGCAGTGGTCGTTGATGACGTCTTAGTTGTCAACGTATATGCACCGACAGAAAGAAGTGACCAAAATAGACTTTTTTTCGTC
GATTACAGATATGGCCCTGGCCGGGATTAAATGTGGTTCTACTTGGAGATTCTACTTGGAGATTCTACTTGTGTCCAATAGCCTTTATCTGGACCGCTTG
GGGGATAAGGTCAGGCTGACCTGAAAGCCCTGTTGGAGACATTACTTTACGCATTGGACTCGTAATATGCACAGACACTAGCAGCGTCGGCGGTGGAGGA
CGAATGGTGAAGCTAACGAAGTATAATAATCTTTGGAATGCCCGATCGCCCAGCAGGATAGACCGTGTTTACGTGCCTAAGAACTGGACTGAGTTAGTAC
AACAAGTCCAGGTTCGTCTACCAGTGGTTCAATCTGATCACCAAACAATTACCATCTGTCGCGGATAGCGAGCACTGGAGGCATAGACGTCCTCGACTAG
TACCCGTCCATTATTACATTAGTACGACGGACCCGGAACGAGTTTATGAATACATACTCGATTGTTTGATACGGAAAGAATCTTCCGACACTTCCATACA
AGTACGTTGGAAAAGGCGGTGCGGAATTGCGGATGGAGCATCAAACGGATCACAGAACAGAAAAACAACAACGGACACGCAGAATTAAACGAAAGCTCCA
GGCACAGGCCCGCACGCAACTTC