Description :
From Genome Similarity Track
Location :
Scaffold_10:8417- 10114
Sequence
1697 bases(100 bases per row)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAA
GGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATT
ACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTGTTTGTCCGCGACGATGCCCGGCATCGCCGCGTCGACCACCATCTCGGTGCACGGGTG
CCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCATCGTACATTACTTCCTTGTTGCTGTTGATAACCAACAGCCGTTGCATTCGAGAG
GTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGGTTGCAGCCTCGGCGCATTCGCCTGTAGTTTAGCCTGCCTCAGTCTAAACTCCTCCTGC
ATCGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACTGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGACCCTTTATGAACGTGACGACCT
TGGTCGCCTCGTCTATCGGGTTGGTCACAATGTTCGAGACCAAATACCGTGCTCTCTGCGCGTAAGCATGGACATCATGCTTACCCTGCTGTAGGTCGAG
GAACTCTGCCCTCGACGAAACTCATTTTGCGGGGGCTCAAACGCTTGTCTGAGTTCCTCCTTGAAACCCTCAAACGTACTGAAGCACGTAGGATCAGAGA
GTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGC
AGTGTCGAGTTCGACAAGCCAACTGAGGAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCC
GACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCCGTCGGCGTTAGCGTACGCAGCATCG
TAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCTTACCACTCTGGGTCCGACAGATGGGGACAGTCAGCGCGTGCAACGTGAGTTGC
AGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGG
ATGGACTACGAAGTGCTACTAGGTGTAATGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAA
ATTAGGGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTAGTTTTGTTTT
ATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGA
GATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT